Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209797289:

Variant ID: vg1209797289 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9797289
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAGTGTCAGATCCACACCTGTTGCAATGCTTGTTAACATTGCTACGAGGTTGTGGTGCCTTATCCTTCCCTTTTCCTTTCTTTCGACCCTTGAATTTG[C/T]
GCCTGTTGTTGTTGCGTTTGCGCTTTCCAGTCAGATTCTTAGGATTATTGGAAGAATTTCCCTTGAATCCTTTCTTATTCTCAGCATTATTCTGTACATT

Reverse complement sequence

AATGTACAGAATAATGCTGAGAATAAGAAAGGATTCAAGGGAAATTCTTCCAATAATCCTAAGAATCTGACTGGAAAGCGCAAACGCAACAACAACAGGC[G/A]
CAAATTCAAGGGTCGAAAGAAAGGAAAAGGGAAGGATAAGGCACCACAACCTCGTAGCAATGTTAACAAGCATTGCAACAGGTGTGGATCTGACACTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.40%	19.40%	0.72%	0.44%	NA
All Indica	2759	70.00%	28.60%	0.76%	0.62%	NA
All Japonica	1512	92.30%	6.70%	0.73%	0.26%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	79.50%	20.50%	0.00%	0.00%	NA
Indica II	465	55.90%	38.30%	3.23%	2.58%	NA
Indica III	913	70.80%	28.90%	0.33%	0.00%	NA
Indica Intermediate	786	70.40%	28.60%	0.38%	0.64%	NA
Temperate Japonica	767	96.60%	1.40%	1.43%	0.52%	NA
Tropical Japonica	504	89.70%	10.30%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	11.50%	1.04%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209797289	C -> DEL	LOC_Os12g17110.1	N	frameshift_variant	Average:39.197; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg1209797289	C -> T	LOC_Os12g17110.1	missense_variant ; p.Arg236His; MODERATE	nonsynonymous_codon ; R236H	Average:39.197; most accessible tissue: Minghui63 flag leaf, score: 58.568	unknown	unknown	TOLERATED	0.22

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209797289	8.99E-07	2.84E-07	mr1071_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209797289	8.54E-07	4.03E-08	mr1080_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209797289	3.25E-06	1.67E-07	mr1100_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209797289	3.97E-06	3.29E-07	mr1203_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209797289	2.78E-07	4.33E-08	mr1402_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209797289	7.93E-07	1.37E-06	mr1613_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209797289	6.68E-06	1.90E-06	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209797289	5.84E-06	1.99E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251