\
| Variant ID: vg1209797289 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9797289 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 186. )
ATGAGTGTCAGATCCACACCTGTTGCAATGCTTGTTAACATTGCTACGAGGTTGTGGTGCCTTATCCTTCCCTTTTCCTTTCTTTCGACCCTTGAATTTG[C/T]
GCCTGTTGTTGTTGCGTTTGCGCTTTCCAGTCAGATTCTTAGGATTATTGGAAGAATTTCCCTTGAATCCTTTCTTATTCTCAGCATTATTCTGTACATT
AATGTACAGAATAATGCTGAGAATAAGAAAGGATTCAAGGGAAATTCTTCCAATAATCCTAAGAATCTGACTGGAAAGCGCAAACGCAACAACAACAGGC[G/A]
CAAATTCAAGGGTCGAAAGAAAGGAAAAGGGAAGGATAAGGCACCACAACCTCGTAGCAATGTTAACAAGCATTGCAACAGGTGTGGATCTGACACTCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.40% | 19.40% | 0.72% | 0.44% | NA |
| All Indica | 2759 | 70.00% | 28.60% | 0.76% | 0.62% | NA |
| All Japonica | 1512 | 92.30% | 6.70% | 0.73% | 0.26% | NA |
| Aus | 269 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.50% | 20.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 55.90% | 38.30% | 3.23% | 2.58% | NA |
| Indica III | 913 | 70.80% | 28.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 70.40% | 28.60% | 0.38% | 0.64% | NA |
| Temperate Japonica | 767 | 96.60% | 1.40% | 1.43% | 0.52% | NA |
| Tropical Japonica | 504 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 11.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209797289 | C -> DEL | LOC_Os12g17110.1 | N | frameshift_variant | Average:39.197; most accessible tissue: Minghui63 flag leaf, score: 58.568 | N | N | N | N |
| vg1209797289 | C -> T | LOC_Os12g17110.1 | missense_variant ; p.Arg236His; MODERATE | nonsynonymous_codon ; R236H | Average:39.197; most accessible tissue: Minghui63 flag leaf, score: 58.568 | unknown | unknown | TOLERATED | 0.22 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209797289 | 8.99E-07 | 2.84E-07 | mr1071_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209797289 | 8.54E-07 | 4.03E-08 | mr1080_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209797289 | 3.25E-06 | 1.67E-07 | mr1100_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209797289 | 3.97E-06 | 3.29E-07 | mr1203_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209797289 | 2.78E-07 | 4.33E-08 | mr1402_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209797289 | 7.93E-07 | 1.37E-06 | mr1613_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209797289 | 6.68E-06 | 1.90E-06 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209797289 | 5.84E-06 | 1.99E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |