\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209773540:

Variant ID: vg1209773540 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9773540
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATTTTACCGGGACTAAAGATAATTTCACTCCGGGTTCAATAGTTGTTAGGTCGTGTCAGGCCCCCAACGACTTTTTGTCCTGGTTGGTATCACCAACC[A/G]
GGACTAAATATCTCTCTTCCACCTCCTTATTTTATCTCCCACGCCTCTCTCTCGATTTCCTCGTCTATCTTCCACGTGGCCTCTGCTCTCTCTATCTCTC

Reverse complement sequence

GAGAGATAGAGAGAGCAGAGGCCACGTGGAAGATAGACGAGGAAATCGAGAGAGAGGCGTGGGAGATAAAATAAGGAGGTGGAAGAGAGATATTTAGTCC[T/C]
GGTTGGTGATACCAACCAGGACAAAAAGTCGTTGGGGGCCTGACACGACCTAACAACTATTGAACCCGGAGTGAAATTATCTTTAGTCCCGGTAAAATTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.30% 2.90% 0.80% 0.00% NA
All Indica  2759 99.60% 0.30% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 53.90% 36.80% 9.29% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 18.80% 9.38% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209773540 A -> G LOC_Os12g17070.1 upstream_gene_variant ; 1209.0bp to feature; MODIFIER silent_mutation Average:59.637; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1209773540 A -> G LOC_Os12g17080.1 upstream_gene_variant ; 4211.0bp to feature; MODIFIER silent_mutation Average:59.637; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1209773540 A -> G LOC_Os12g17070.2 upstream_gene_variant ; 1209.0bp to feature; MODIFIER silent_mutation Average:59.637; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N
vg1209773540 A -> G LOC_Os12g17070-LOC_Os12g17080 intergenic_region ; MODIFIER silent_mutation Average:59.637; most accessible tissue: Zhenshan97 young leaf, score: 77.422 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209773540 NA 3.93E-13 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209773540 NA 7.56E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209773540 NA 2.52E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209773540 3.07E-06 NA mr1907_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251