Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209700334:

Variant ID: vg1209700334 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9700334
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.18, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCCTCGGCTGATTCCTGGACGAGGGTTTACACACATGTAAGCGTTTGGAATTTTGGATAGAAATTCCGGGCGTGACATTGATTGACTCGCTCGGTCT[A/G]
GCCATCTGTTTGTGGATGGTAAGCAGTGCTGAAGTTCAGAAGGGTTCCCAATTCCTCTTGTAATTTCTGCTAGAACTTTGAAGTGAATTGGCTCCCTCGA

Reverse complement sequence

TCGAGGGAGCCAATTCACTTCAAAGTTCTAGCAGAAATTACAAGAGGAATTGGGAACCCTTCTGAACTTCAGCACTGCTTACCATCCACAAACAGATGGC[T/C]
AGACCGAGCGAGTCAATCAATGTCACGCCCGGAATTTCTATCCAAAATTCCAAACGCTTACATGTGTGTAAACCCTCGTCCAGGAATCAGCCGAGGCACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.30%	35.60%	0.44%	26.64%	NA
All Indica	2759	20.50%	38.00%	0.51%	41.03%	NA
All Japonica	1512	74.50%	21.80%	0.13%	3.57%	NA
Aus	269	4.10%	78.10%	1.49%	16.36%	NA
Indica I	595	31.80%	46.90%	1.18%	20.17%	NA
Indica II	465	31.00%	37.60%	0.22%	31.18%	NA
Indica III	913	6.20%	29.40%	0.44%	63.96%	NA
Indica Intermediate	786	22.30%	41.50%	0.25%	36.01%	NA
Temperate Japonica	767	84.70%	9.00%	0.13%	6.13%	NA
Tropical Japonica	504	67.30%	31.50%	0.20%	0.99%	NA
Japonica Intermediate	241	56.80%	42.30%	0.00%	0.83%	NA
VI/Aromatic	96	15.60%	63.50%	1.04%	19.79%	NA
Intermediate	90	50.00%	38.90%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209700334	A -> DEL	N	N	silent_mutation	Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg1209700334	A -> G	LOC_Os12g16910.1	downstream_gene_variant ; 1713.0bp to feature; MODIFIER	silent_mutation	Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg1209700334	A -> G	LOC_Os12g16920.1	downstream_gene_variant ; 70.0bp to feature; MODIFIER	silent_mutation	Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg1209700334	A -> G	LOC_Os12g16930.1	downstream_gene_variant ; 3367.0bp to feature; MODIFIER	silent_mutation	Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N
vg1209700334	A -> G	LOC_Os12g16910-LOC_Os12g16920	intergenic_region ; MODIFIER	silent_mutation	Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209700334	NA	6.77E-06	mr1018	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	9.44E-11	mr1023	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	7.51E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	1.26E-11	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	3.75E-10	mr1132	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	5.22E-12	mr1142	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	9.69E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	2.47E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	8.66E-06	7.05E-10	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	1.34E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	8.43E-06	4.44E-13	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	1.90E-06	NA	mr1558	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	5.75E-06	2.30E-09	mr1558	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	9.65E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334	NA	2.43E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251