\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209700334:

Variant ID: vg1209700334 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9700334
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.18, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCCTCGGCTGATTCCTGGACGAGGGTTTACACACATGTAAGCGTTTGGAATTTTGGATAGAAATTCCGGGCGTGACATTGATTGACTCGCTCGGTCT[A/G]
GCCATCTGTTTGTGGATGGTAAGCAGTGCTGAAGTTCAGAAGGGTTCCCAATTCCTCTTGTAATTTCTGCTAGAACTTTGAAGTGAATTGGCTCCCTCGA

Reverse complement sequence

TCGAGGGAGCCAATTCACTTCAAAGTTCTAGCAGAAATTACAAGAGGAATTGGGAACCCTTCTGAACTTCAGCACTGCTTACCATCCACAAACAGATGGC[T/C]
AGACCGAGCGAGTCAATCAATGTCACGCCCGGAATTTCTATCCAAAATTCCAAACGCTTACATGTGTGTAAACCCTCGTCCAGGAATCAGCCGAGGCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 35.60% 0.44% 26.64% NA
All Indica  2759 20.50% 38.00% 0.51% 41.03% NA
All Japonica  1512 74.50% 21.80% 0.13% 3.57% NA
Aus  269 4.10% 78.10% 1.49% 16.36% NA
Indica I  595 31.80% 46.90% 1.18% 20.17% NA
Indica II  465 31.00% 37.60% 0.22% 31.18% NA
Indica III  913 6.20% 29.40% 0.44% 63.96% NA
Indica Intermediate  786 22.30% 41.50% 0.25% 36.01% NA
Temperate Japonica  767 84.70% 9.00% 0.13% 6.13% NA
Tropical Japonica  504 67.30% 31.50% 0.20% 0.99% NA
Japonica Intermediate  241 56.80% 42.30% 0.00% 0.83% NA
VI/Aromatic  96 15.60% 63.50% 1.04% 19.79% NA
Intermediate  90 50.00% 38.90% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209700334 A -> DEL N N silent_mutation Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1209700334 A -> G LOC_Os12g16910.1 downstream_gene_variant ; 1713.0bp to feature; MODIFIER silent_mutation Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1209700334 A -> G LOC_Os12g16920.1 downstream_gene_variant ; 70.0bp to feature; MODIFIER silent_mutation Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1209700334 A -> G LOC_Os12g16930.1 downstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N
vg1209700334 A -> G LOC_Os12g16910-LOC_Os12g16920 intergenic_region ; MODIFIER silent_mutation Average:34.646; most accessible tissue: Minghui63 flag leaf, score: 64.867 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209700334 NA 6.77E-06 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 9.44E-11 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 7.51E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 1.26E-11 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 3.75E-10 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 5.22E-12 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 9.69E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 2.47E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 8.66E-06 7.05E-10 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 1.34E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 8.43E-06 4.44E-13 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 1.90E-06 NA mr1558 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 5.75E-06 2.30E-09 mr1558 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 9.65E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209700334 NA 2.43E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251