Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209678411:

Variant ID: vg1209678411 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9678411
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCACAGACCAACACAACCCTTTTCTGCACACTTTGTCCTCACTCGTACGCACCCGTAAAGAATTTCCCGGTGGGTCACCTATCCCGAAATTGCTCCAGG[T/C]
TAAGCATGAAATTGCTCCAGGCCAAGCATGCTTAACCTCGGAGTTCTTTTGAGATCGGCTTTAGGAAAAGAAGTTGCAACTTGTTGATATGAGTATTCTA

Reverse complement sequence

TAGAATACTCATATCAACAAGTTGCAACTTCTTTTCCTAAAGCCGATCTCAAAAGAACTCCGAGGTTAAGCATGCTTGGCCTGGAGCAATTTCATGCTTA[A/G]
CCTGGAGCAATTTCGGGATAGGTGACCCACCGGGAAATTCTTTACGGGTGCGTACGAGTGAGGACAAAGTGTGCAGAAAAGGGTTGTGTTGGTCTGTGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	0.30%	2.18%	23.78%	NA
All Indica	2759	60.60%	0.30%	2.54%	36.61%	NA
All Japonica	1512	95.80%	0.10%	0.93%	3.17%	NA
Aus	269	80.30%	0.40%	4.46%	14.87%	NA
Indica I	595	85.00%	0.00%	1.18%	13.78%	NA
Indica II	465	68.20%	0.20%	3.87%	27.74%	NA
Indica III	913	36.10%	0.40%	2.63%	60.79%	NA
Indica Intermediate	786	66.00%	0.30%	2.67%	31.04%	NA
Temperate Japonica	767	94.40%	0.10%	0.13%	5.35%	NA
Tropical Japonica	504	96.40%	0.20%	2.18%	1.19%	NA
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.41%	NA
VI/Aromatic	96	71.90%	2.10%	4.17%	21.88%	NA
Intermediate	90	91.10%	0.00%	3.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209678411	T -> C	LOC_Os12g16870.1	upstream_gene_variant ; 2796.0bp to feature; MODIFIER	silent_mutation	Average:56.235; most accessible tissue: Minghui63 young leaf, score: 82.907	N	N	N	N
vg1209678411	T -> C	LOC_Os12g16870-LOC_Os12g16880	intergenic_region ; MODIFIER	silent_mutation	Average:56.235; most accessible tissue: Minghui63 young leaf, score: 82.907	N	N	N	N
vg1209678411	T -> DEL	N	N	silent_mutation	Average:56.235; most accessible tissue: Minghui63 young leaf, score: 82.907	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209678411	NA	8.70E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	5.25E-06	5.25E-06	mr1060	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	3.07E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	1.35E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	1.39E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	2.05E-06	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	2.57E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	4.39E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	7.38E-06	7.52E-08	mr1332	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	2.90E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	3.72E-06	3.31E-09	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	2.49E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	3.72E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	7.82E-06	mr1906	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	3.05E-06	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	5.03E-07	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209678411	NA	3.89E-07	mr1425_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251