\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209657848:

Variant ID: vg1209657848 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9657848
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TCATGTAGGTATAGTGCGGGACAGCCATAAATTTGGCTAACGCCGGGCGCCCGAGTATGCCATGATACGCTGTCTCGAAATCAGCAACTTCAAAGCAGAC[G/A]
TTTTCTGTGCGGAAGTTTTCCCGAGTACCAAAGGTGACCGGAAGAGTGATCTGGCCGAGTGGCGTAGCAGACAGCCCTGGGATGACTCCGTGAAAGGGTG

Reverse complement sequence

CACCCTTTCACGGAGTCATCCCAGGGCTGTCTGCTACGCCACTCGGCCAGATCACTCTTCCGGTCACCTTTGGTACTCGGGAAAACTTCCGCACAGAAAA[C/T]
GTCTGCTTTGAAGTTGCTGATTTCGAGACAGCGTATCATGGCATACTCGGGCGCCCGGCGTTAGCCAAATTTATGGCTGTCCCGCACTATACCTACATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 25.10% 6.79% 28.25% NA
All Indica  2759 22.10% 23.30% 9.68% 44.94% NA
All Japonica  1512 78.40% 17.10% 0.73% 3.84% NA
Aus  269 10.80% 74.70% 12.27% 2.23% NA
Indica I  595 10.80% 46.70% 7.90% 34.62% NA
Indica II  465 45.60% 7.70% 5.16% 41.51% NA
Indica III  913 14.90% 16.10% 14.46% 54.55% NA
Indica Intermediate  786 25.20% 23.00% 8.14% 43.64% NA
Temperate Japonica  767 85.30% 7.00% 0.91% 6.78% NA
Tropical Japonica  504 73.80% 24.80% 0.20% 1.19% NA
Japonica Intermediate  241 66.00% 32.80% 1.24% 0.00% NA
VI/Aromatic  96 14.60% 58.30% 8.33% 18.75% NA
Intermediate  90 51.10% 32.20% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209657848 G -> DEL LOC_Os12g16840.1 N frameshift_variant Average:63.197; most accessible tissue: Minghui63 young leaf, score: 87.823 N N N N
vg1209657848 G -> A LOC_Os12g16840.1 synonymous_variant ; p.Asn730Asn; LOW synonymous_codon Average:63.197; most accessible tissue: Minghui63 young leaf, score: 87.823 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209657848 G A -0.02 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209657848 NA 4.85E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209657848 NA 9.28E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209657848 NA 5.32E-10 mr1915 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209657848 NA 1.64E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209657848 NA 8.17E-07 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251