\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209593468:

Variant ID: vg1209593468 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9593468
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGTCTATGAGATTTGGGCGATCTCTAGATACTCATGAAAAGGCCTGTAGTTTGACTTATATGCTCCAAACAGAGGGGATGCGAACGGCAGCCCAGTAC[C/T]
AGTCAAGGGTTTGAGTGAAACCTAATCACACAAGACTGATAATTCAAGGCATAGTCCATTGTTCAGTTGTGGTTTGATGTAGCTCATTTCCTAGGTGGAA

Reverse complement sequence

TTCCACCTAGGAAATGAGCTACATCAAACCACAACTGAACAATGGACTATGCCTTGAATTATCAGTCTTGTGTGATTAGGTTTCACTCAAACCCTTGACT[G/A]
GTACTGGGCTGCCGTTCGCATCCCCTCTGTTTGGAGCATATAAGTCAAACTACAGGCCTTTTCATGAGTATCTAGAGATCGCCCAAATCTCATAGACTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.10% 24.70% 0.13% 0.00% NA
All Indica  2759 76.90% 23.00% 0.11% 0.00% NA
All Japonica  1512 83.50% 16.30% 0.13% 0.00% NA
Aus  269 20.40% 79.20% 0.37% 0.00% NA
Indica I  595 55.60% 44.00% 0.34% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 83.80% 16.10% 0.11% 0.00% NA
Indica Intermediate  786 76.10% 23.90% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 6.30% 0.26% 0.00% NA
Tropical Japonica  504 75.80% 24.20% 0.00% 0.00% NA
Japonica Intermediate  241 68.00% 32.00% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209593468 C -> T LOC_Os12g16730.1 downstream_gene_variant ; 3180.0bp to feature; MODIFIER silent_mutation Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1209593468 C -> T LOC_Os12g16740.1 downstream_gene_variant ; 823.0bp to feature; MODIFIER silent_mutation Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1209593468 C -> T LOC_Os12g16740-LOC_Os12g16750 intergenic_region ; MODIFIER silent_mutation Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209593468 NA 1.97E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468 3.20E-06 6.09E-06 mr1041 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468 2.01E-06 4.86E-06 mr1163 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468 NA 3.87E-06 mr1173 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468 NA 4.58E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468 NA 2.98E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468 NA 1.17E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468 NA 3.90E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251