Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209593468:

Variant ID: vg1209593468 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9593468
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGTCTATGAGATTTGGGCGATCTCTAGATACTCATGAAAAGGCCTGTAGTTTGACTTATATGCTCCAAACAGAGGGGATGCGAACGGCAGCCCAGTAC[C/T]
AGTCAAGGGTTTGAGTGAAACCTAATCACACAAGACTGATAATTCAAGGCATAGTCCATTGTTCAGTTGTGGTTTGATGTAGCTCATTTCCTAGGTGGAA

Reverse complement sequence

TTCCACCTAGGAAATGAGCTACATCAAACCACAACTGAACAATGGACTATGCCTTGAATTATCAGTCTTGTGTGATTAGGTTTCACTCAAACCCTTGACT[G/A]
GTACTGGGCTGCCGTTCGCATCCCCTCTGTTTGGAGCATATAAGTCAAACTACAGGCCTTTTCATGAGTATCTAGAGATCGCCCAAATCTCATAGACTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	24.70%	0.13%	0.00%	NA
All Indica	2759	76.90%	23.00%	0.11%	0.00%	NA
All Japonica	1512	83.50%	16.30%	0.13%	0.00%	NA
Aus	269	20.40%	79.20%	0.37%	0.00%	NA
Indica I	595	55.60%	44.00%	0.34%	0.00%	NA
Indica II	465	92.00%	8.00%	0.00%	0.00%	NA
Indica III	913	83.80%	16.10%	0.11%	0.00%	NA
Indica Intermediate	786	76.10%	23.90%	0.00%	0.00%	NA
Temperate Japonica	767	93.50%	6.30%	0.26%	0.00%	NA
Tropical Japonica	504	75.80%	24.20%	0.00%	0.00%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	44.80%	55.20%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209593468	C -> T	LOC_Os12g16730.1	downstream_gene_variant ; 3180.0bp to feature; MODIFIER	silent_mutation	Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1209593468	C -> T	LOC_Os12g16740.1	downstream_gene_variant ; 823.0bp to feature; MODIFIER	silent_mutation	Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1209593468	C -> T	LOC_Os12g16740-LOC_Os12g16750	intergenic_region ; MODIFIER	silent_mutation	Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209593468	NA	1.97E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468	3.20E-06	6.09E-06	mr1041	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468	2.01E-06	4.86E-06	mr1163	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468	NA	3.87E-06	mr1173	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468	NA	4.58E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468	NA	2.98E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468	NA	1.17E-06	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209593468	NA	3.90E-07	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251