\
| Variant ID: vg1209593468 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9593468 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 120. )
ACAGTCTATGAGATTTGGGCGATCTCTAGATACTCATGAAAAGGCCTGTAGTTTGACTTATATGCTCCAAACAGAGGGGATGCGAACGGCAGCCCAGTAC[C/T]
AGTCAAGGGTTTGAGTGAAACCTAATCACACAAGACTGATAATTCAAGGCATAGTCCATTGTTCAGTTGTGGTTTGATGTAGCTCATTTCCTAGGTGGAA
TTCCACCTAGGAAATGAGCTACATCAAACCACAACTGAACAATGGACTATGCCTTGAATTATCAGTCTTGTGTGATTAGGTTTCACTCAAACCCTTGACT[G/A]
GTACTGGGCTGCCGTTCGCATCCCCTCTGTTTGGAGCATATAAGTCAAACTACAGGCCTTTTCATGAGTATCTAGAGATCGCCCAAATCTCATAGACTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 24.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 76.90% | 23.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 83.50% | 16.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 20.40% | 79.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 55.60% | 44.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.80% | 16.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 76.10% | 23.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.50% | 6.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 75.80% | 24.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209593468 | C -> T | LOC_Os12g16730.1 | downstream_gene_variant ; 3180.0bp to feature; MODIFIER | silent_mutation | Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1209593468 | C -> T | LOC_Os12g16740.1 | downstream_gene_variant ; 823.0bp to feature; MODIFIER | silent_mutation | Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg1209593468 | C -> T | LOC_Os12g16740-LOC_Os12g16750 | intergenic_region ; MODIFIER | silent_mutation | Average:38.392; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209593468 | NA | 1.97E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209593468 | 3.20E-06 | 6.09E-06 | mr1041 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209593468 | 2.01E-06 | 4.86E-06 | mr1163 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209593468 | NA | 3.87E-06 | mr1173 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209593468 | NA | 4.58E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209593468 | NA | 2.98E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209593468 | NA | 1.17E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209593468 | NA | 3.90E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |