\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209505768:

Variant ID: vg1209505768 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9505768
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, G: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGCAACAAAGAATCTTAGCAGTGAAACAATGATGAGGTGGCCTTACCAATATAATGAGTCACTTCCATATAGGAATTAAAAATCATGTTCATTTATTT[C/G]
TTTTTGGTAGAACTTGCTACGCTACGTTGTAAATTCCTAACATTTAGTGTAGAACAATTTAGAAATGTGTATTTATTACATGACCTCTATTTTAATATTT

Reverse complement sequence

AAATATTAAAATAGAGGTCATGTAATAAATACACATTTCTAAATTGTTCTACACTAAATGTTAGGAATTTACAACGTAGCGTAGCAAGTTCTACCAAAAA[G/C]
AAATAAATGAACATGATTTTTAATTCCTATATGGAAGTGACTCATTATATTGGTAAGGCCACCTCATCATTGTTTCACTGCTAAGATTCTTTGTTGCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.20% 0.04% 0.00% NA
All Indica  2759 89.60% 10.30% 0.07% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 70.50% 29.50% 0.00% 0.00% NA
Indica III  913 94.10% 5.90% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 11.50% 0.25% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209505768 C -> G LOC_Os12g16610.1 downstream_gene_variant ; 1155.0bp to feature; MODIFIER silent_mutation Average:28.267; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg1209505768 C -> G LOC_Os12g16610-LOC_Os12g16620 intergenic_region ; MODIFIER silent_mutation Average:28.267; most accessible tissue: Minghui63 root, score: 49.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209505768 NA 5.36E-07 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209505768 2.00E-06 1.69E-06 mr1182_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209505768 NA 9.62E-06 mr1399_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209505768 5.51E-06 5.51E-06 mr1584_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209505768 NA 9.97E-06 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209505768 NA 1.88E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251