\
| Variant ID: vg1209461512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9461512 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 77. )
TTTTTTGTCCATTCCTTTTTCATTTTTTTGGTTTATTGGGGTTTGTTATACAAACTAGGTATATACACATACACTATGATGACCACTTTGCCCCTTGTTA[T/C]
GTCTTTGCCAGCGTGTATACTTTTTTTTATATTTTATACATACATACATATACAAATTTAATTTTGTATACATGTATATATATATATATATTCTCTATAT
ATATAGAGAATATATATATATATATACATGTATACAAAATTAAATTTGTATATGTATGTATGTATAAAATATAAAAAAAAGTATACACGCTGGCAAAGAC[A/G]
TAACAAGGGGCAAAGTGGTCATCATAGTGTATGTGTATATACCTAGTTTGTATAACAAACCCCAATAAACCAAAAAAATGAAAAAGGAATGGACAAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.10% | 28.30% | 0.23% | 8.29% | NA |
| All Indica | 2759 | 83.60% | 4.90% | 0.25% | 11.24% | NA |
| All Japonica | 1512 | 22.30% | 75.10% | 0.07% | 2.58% | NA |
| Aus | 269 | 78.80% | 5.60% | 0.37% | 15.24% | NA |
| Indica I | 595 | 96.80% | 2.20% | 0.00% | 1.01% | NA |
| Indica II | 465 | 57.60% | 12.30% | 0.22% | 29.89% | NA |
| Indica III | 913 | 88.90% | 3.10% | 0.33% | 7.67% | NA |
| Indica Intermediate | 786 | 82.70% | 4.80% | 0.38% | 12.09% | NA |
| Temperate Japonica | 767 | 15.10% | 82.80% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 27.60% | 72.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 34.00% | 56.40% | 0.41% | 9.13% | NA |
| VI/Aromatic | 96 | 81.20% | 17.70% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 56.70% | 40.00% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209461512 | T -> C | LOC_Os12g16524.1 | upstream_gene_variant ; 4731.0bp to feature; MODIFIER | silent_mutation | Average:57.216; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg1209461512 | T -> C | LOC_Os12g16524.2 | upstream_gene_variant ; 4731.0bp to feature; MODIFIER | silent_mutation | Average:57.216; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg1209461512 | T -> C | LOC_Os12g16524.3 | upstream_gene_variant ; 4731.0bp to feature; MODIFIER | silent_mutation | Average:57.216; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg1209461512 | T -> C | LOC_Os12g16510.1 | downstream_gene_variant ; 4457.0bp to feature; MODIFIER | silent_mutation | Average:57.216; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg1209461512 | T -> C | LOC_Os12g16520.1 | downstream_gene_variant ; 2421.0bp to feature; MODIFIER | silent_mutation | Average:57.216; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg1209461512 | T -> C | LOC_Os12g16510-LOC_Os12g16520 | intergenic_region ; MODIFIER | silent_mutation | Average:57.216; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| vg1209461512 | T -> DEL | N | N | silent_mutation | Average:57.216; most accessible tissue: Minghui63 root, score: 70.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209461512 | NA | 1.58E-51 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 3.68E-32 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.17E-38 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 4.49E-26 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.45E-06 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.02E-36 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | 5.61E-07 | 7.64E-32 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 6.30E-23 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.17E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 9.84E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.30E-38 | mr1055 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 8.90E-29 | mr1055 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 7.99E-53 | mr1079 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 7.84E-35 | mr1079 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.33E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 5.18E-23 | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 9.64E-25 | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 4.83E-07 | mr1177 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 6.95E-61 | mr1178 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | 5.21E-06 | 1.60E-28 | mr1178 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.77E-09 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 5.85E-12 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.19E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.08E-60 | mr1390 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 4.22E-30 | mr1390 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.15E-08 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 3.11E-06 | mr1482 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.72E-12 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.95E-59 | mr1490 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.02E-28 | mr1490 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 9.04E-62 | mr1491 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | 8.30E-06 | 2.96E-25 | mr1491 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.83E-34 | mr1546 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.30E-18 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.04E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.98E-41 | mr1022_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 9.44E-33 | mr1022_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.72E-17 | mr1023_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.67E-51 | mr1055_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 7.15E-30 | mr1055_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 6.91E-06 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.17E-54 | mr1079_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | 7.71E-06 | 1.99E-30 | mr1079_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 7.91E-08 | mr1089_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.82E-09 | mr1093_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 7.69E-27 | mr1132_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 8.12E-06 | mr1173_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.00E-76 | mr1178_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 4.40E-30 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 4.04E-09 | mr1235_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 3.13E-06 | mr1243_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.13E-15 | mr1301_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 8.35E-70 | mr1390_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.57E-32 | mr1390_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.54E-06 | mr1423_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 6.54E-16 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.61E-68 | mr1490_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 6.04E-28 | mr1490_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 5.15E-15 | mr1546_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.63E-06 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.34E-07 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.03E-08 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 4.73E-09 | mr1599_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | 1.28E-06 | 3.87E-08 | mr1622_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 4.87E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 1.64E-08 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 2.47E-07 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209461512 | NA | 3.32E-09 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |