\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209431333:

Variant ID: vg1209431333 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9431333
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGTGTACATACATATATAGGGATAGATTAGCTGATTTTTAGGAGCAAGTGATTATAATATATCTAATCTAATGGTTGAAAATTATGGATTGATCGTT[T/G]
TAAGTGTAAATTGATGACTTACATGTTTTTCTTTTTATTGTATTTTTCTCTTCTTTATTTGAGCATCATATAGCATCTTAGGAGTGTTTGTAGGAGTATA

Reverse complement sequence

TATACTCCTACAAACACTCCTAAGATGCTATATGATGCTCAAATAAAGAAGAGAAAAATACAATAAAAAGAAAAACATGTAAGTCATCAATTTACACTTA[A/C]
AACGATCAATCCATAATTTTCAACCATTAGATTAGATATATTATAATCACTTGCTCCTAAAAATCAGCTAATCTATCCCTATATATGTATGTACACAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 1.70% 2.20% 0.66% NA
All Indica  2759 97.50% 0.00% 2.14% 0.36% NA
All Japonica  1512 92.00% 5.10% 2.78% 0.13% NA
Aus  269 92.90% 0.00% 0.37% 6.69% NA
Indica I  595 92.90% 0.00% 7.06% 0.00% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 99.10% 0.10% 0.33% 0.44% NA
Indica Intermediate  786 97.80% 0.00% 1.40% 0.76% NA
Temperate Japonica  767 97.70% 2.00% 0.39% 0.00% NA
Tropical Japonica  504 83.50% 9.70% 6.35% 0.40% NA
Japonica Intermediate  241 91.70% 5.40% 2.90% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209431333 T -> DEL N N silent_mutation Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1209431333 T -> G LOC_Os12g16470.1 upstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1209431333 T -> G LOC_Os12g16480.1 downstream_gene_variant ; 4601.0bp to feature; MODIFIER silent_mutation Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg1209431333 T -> G LOC_Os12g16460-LOC_Os12g16470 intergenic_region ; MODIFIER silent_mutation Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209431333 NA 1.20E-09 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 7.76E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 1.59E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 3.99E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 1.26E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 8.58E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 8.10E-06 8.09E-06 mr1184 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 3.17E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 6.39E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 1.26E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 6.41E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 3.01E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 1.22E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 3.84E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 5.82E-06 1.65E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 NA 2.05E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 6.03E-08 1.32E-17 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333 7.37E-07 7.95E-17 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251