Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209431333:

Variant ID: vg1209431333 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9431333
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTGTGTACATACATATATAGGGATAGATTAGCTGATTTTTAGGAGCAAGTGATTATAATATATCTAATCTAATGGTTGAAAATTATGGATTGATCGTT[T/G]
TAAGTGTAAATTGATGACTTACATGTTTTTCTTTTTATTGTATTTTTCTCTTCTTTATTTGAGCATCATATAGCATCTTAGGAGTGTTTGTAGGAGTATA

Reverse complement sequence

TATACTCCTACAAACACTCCTAAGATGCTATATGATGCTCAAATAAAGAAGAGAAAAATACAATAAAAAGAAAAACATGTAAGTCATCAATTTACACTTA[A/C]
AACGATCAATCCATAATTTTCAACCATTAGATTAGATATATTATAATCACTTGCTCCTAAAAATCAGCTAATCTATCCCTATATATGTATGTACACAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.50%	1.70%	2.20%	0.66%	NA
All Indica	2759	97.50%	0.00%	2.14%	0.36%	NA
All Japonica	1512	92.00%	5.10%	2.78%	0.13%	NA
Aus	269	92.90%	0.00%	0.37%	6.69%	NA
Indica I	595	92.90%	0.00%	7.06%	0.00%	NA
Indica II	465	99.40%	0.00%	0.65%	0.00%	NA
Indica III	913	99.10%	0.10%	0.33%	0.44%	NA
Indica Intermediate	786	97.80%	0.00%	1.40%	0.76%	NA
Temperate Japonica	767	97.70%	2.00%	0.39%	0.00%	NA
Tropical Japonica	504	83.50%	9.70%	6.35%	0.40%	NA
Japonica Intermediate	241	91.70%	5.40%	2.90%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	95.60%	2.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209431333	T -> DEL	N	N	silent_mutation	Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg1209431333	T -> G	LOC_Os12g16470.1	upstream_gene_variant ; 3662.0bp to feature; MODIFIER	silent_mutation	Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg1209431333	T -> G	LOC_Os12g16480.1	downstream_gene_variant ; 4601.0bp to feature; MODIFIER	silent_mutation	Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg1209431333	T -> G	LOC_Os12g16460-LOC_Os12g16470	intergenic_region ; MODIFIER	silent_mutation	Average:51.753; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209431333	NA	1.20E-09	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	7.76E-11	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	1.59E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	3.99E-11	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	1.26E-08	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	8.58E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	8.10E-06	8.09E-06	mr1184	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	3.17E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	6.39E-13	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	1.26E-13	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	6.41E-06	mr1790	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	3.01E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	1.22E-09	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	3.84E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	5.82E-06	1.65E-15	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	NA	2.05E-14	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	6.03E-08	1.32E-17	mr1390_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209431333	7.37E-07	7.95E-17	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251