Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209419991:

Variant ID: vg1209419991 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9419991
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.57, C: 0.43, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


ACTACGCCTACCTCCAGATGAAGATGCCGGGCCCTGGTGGCCCCATCTCTGTCCATGGCGACATCAAAGTCGCGCTTGCTTGTATGGAGCAGCGCGCGGA[G/C]
CACCTCGCCGCCGCGTCCAAGCCCGAGGGTGGCGACGAGAGGCTCGGCACCTCCGTCCCCGCCGCCCCGAGGCAACGGATGATCACGTGCGACGAGGTCC

Reverse complement sequence

GGACCTCGTCGCACGTGATCATCCGTTGCCTCGGGGCGGCGGGGACGGAGGTGCCGAGCCTCTCGTCGCCACCCTCGGGCTTGGACGCGGCGGCGAGGTG[C/G]
TCCGCGCGCTGCTCCATACAAGCAAGCGCGACTTTGATGTCGCCATGGACAGAGATGGGGCCACCAGGGCCCGGCATCTTCATCTGGAGGTAGGCGTAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 22.10% 4.21% 31.91% NA
All Indica  2759 23.40% 20.80% 6.13% 49.66% NA
All Japonica  1512 82.20% 13.20% 0.86% 3.70% NA
Aus  269 7.10% 72.50% 2.23% 18.22% NA
Indica I  595 24.70% 38.20% 9.24% 27.90% NA
Indica II  465 27.50% 8.60% 1.08% 62.80% NA
Indica III  913 22.20% 14.90% 6.90% 55.97% NA
Indica Intermediate  786 21.20% 21.90% 5.85% 51.02% NA
Temperate Japonica  767 90.90% 3.90% 0.13% 5.08% NA
Tropical Japonica  504 74.40% 20.40% 2.18% 2.98% NA
Japonica Intermediate  241 71.00% 27.80% 0.41% 0.83% NA
VI/Aromatic  96 25.00% 54.20% 2.08% 18.75% NA
Intermediate  90 48.90% 24.40% 10.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209419991 G -> C LOC_Os12g16450.1 missense_variant ; p.Glu294Asp; MODERATE nonsynonymous_codon ; E294D Average:66.994; most accessible tissue: Minghui63 flag leaf, score: 89.425 benign -1.408 TOLERATED 1.00
vg1209419991 G -> DEL LOC_Os12g16450.1 N frameshift_variant Average:66.994; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209419991 G C 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209419991 NA 2.94E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209419991 NA 3.49E-06 mr1350_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209419991 NA 1.59E-10 mr1558_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251