\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209415105:

Variant ID: vg1209415105 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9415105
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.05, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCGGCCGTTGCCCGCCATTCGGCCGCCATTCCCTCGTCAACGCCTCCGACCCAGGAAGATGTGTGTGGGGGGCCGGATGCCTGCCTCGGCTTCGAGC[T/G]
CCGGCGCAACGGTCGACGTGCTGCCCACGCAACGGAGGGTGCCTCCTCGTCCGGAGCGTCACTTCAGTACGGGCGCGGGGGTCGACCCTCCGTGCCCCCG

Reverse complement sequence

CGGGGGCACGGAGGGTCGACCCCCGCGCCCGTACTGAAGTGACGCTCCGGACGAGGAGGCACCCTCCGTTGCGTGGGCAGCACGTCGACCGTTGCGCCGG[A/C]
GCTCGAAGCCGAGGCAGGCATCCGGCCCCCCACACACATCTTCCTGGGTCGGAGGCGTTGACGAGGGAATGGCGGCCGAATGGCGGGCAACGGCCGCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.10% 39.00% 1.65% 5.31% NA
All Indica  2759 70.50% 21.30% 2.03% 6.23% NA
All Japonica  1512 19.20% 77.90% 0.46% 2.38% NA
Aus  269 75.50% 4.10% 4.83% 15.61% NA
Indica I  595 76.50% 22.50% 0.67% 0.34% NA
Indica II  465 48.40% 26.70% 3.23% 21.72% NA
Indica III  913 76.50% 20.00% 1.86% 1.64% NA
Indica Intermediate  786 72.00% 18.60% 2.54% 6.87% NA
Temperate Japonica  767 10.70% 87.40% 0.65% 1.30% NA
Tropical Japonica  504 25.60% 69.40% 0.40% 4.56% NA
Japonica Intermediate  241 33.20% 65.60% 0.00% 1.24% NA
VI/Aromatic  96 75.00% 24.00% 0.00% 1.04% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209415105 T -> DEL LOC_Os12g16440.1 N frameshift_variant Average:77.851; most accessible tissue: Zhenshan97 flag leaf, score: 93.757 N N N N
vg1209415105 T -> G LOC_Os12g16440.1 missense_variant ; p.Leu182Arg; MODERATE nonsynonymous_codon ; L182R Average:77.851; most accessible tissue: Zhenshan97 flag leaf, score: 93.757 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209415105 T G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209415105 NA 4.32E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 6.93E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 1.23E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 5.15E-07 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 6.72E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 4.29E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 1.39E-24 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 1.79E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 1.08E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 1.70E-09 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 4.19E-06 mr1350_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 1.89E-07 mr1509_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 8.31E-07 NA mr1558_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 2.40E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 7.86E-09 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 2.73E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209415105 NA 2.27E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251