\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209414021:

Variant ID: vg1209414021 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9414021
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.22, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CCCATCCCATCGGAGGGTCATTCAGAGAGCAGCCATTGCAAATCTCTGCCCATTTATGAAGGGATGACAGGGTGATTTCCGAGGTCAGACGAGTGAGGAC[A/G]
CCTTGCCACACTCAAGAACAAGCTGTGTTTTAGCTTCCAAGAGAAGGCGAGCCAAGTTTTGGTGAAGGGAGGATGGGTCCCCACCCAAAAGAAAAATAGG

Reverse complement sequence

CCTATTTTTCTTTTGGGTGGGGACCCATCCTCCCTTCACCAAAACTTGGCTCGCCTTCTCTTGGAAGCTAAAACACAGCTTGTTCTTGAGTGTGGCAAGG[T/C]
GTCCTCACTCGTCTGACCTCGGAAATCACCCTGTCATCCCTTCATAAATGGGCAGAGATTTGCAATGGCTGCTCTCTGAATGACCCTCCGATGGGATGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.90% 0.50% 10.66% 47.99% NA
All Indica  2759 22.70% 0.60% 14.57% 62.16% NA
All Japonica  1512 80.90% 0.00% 3.31% 15.81% NA
Aus  269 5.90% 1.10% 8.55% 84.39% NA
Indica I  595 24.50% 0.50% 8.74% 66.22% NA
Indica II  465 26.90% 0.60% 20.00% 52.47% NA
Indica III  913 21.20% 0.40% 15.01% 63.31% NA
Indica Intermediate  786 20.40% 0.90% 15.27% 63.49% NA
Temperate Japonica  767 87.70% 0.00% 3.65% 8.60% NA
Tropical Japonica  504 75.00% 0.00% 2.38% 22.62% NA
Japonica Intermediate  241 71.40% 0.00% 4.15% 24.48% NA
VI/Aromatic  96 24.00% 0.00% 19.79% 56.25% NA
Intermediate  90 50.00% 2.20% 11.11% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209414021 A -> DEL N N silent_mutation Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1209414021 A -> G LOC_Os12g16430.1 upstream_gene_variant ; 2177.0bp to feature; MODIFIER silent_mutation Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1209414021 A -> G LOC_Os12g16440.1 upstream_gene_variant ; 540.0bp to feature; MODIFIER silent_mutation Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1209414021 A -> G LOC_Os12g16450.1 upstream_gene_variant ; 4153.0bp to feature; MODIFIER silent_mutation Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1209414021 A -> G LOC_Os12g16430-LOC_Os12g16440 intergenic_region ; MODIFIER silent_mutation Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209414021 NA 1.04E-11 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 5.77E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 6.57E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 4.10E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 9.83E-07 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 7.50E-13 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 7.44E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 5.76E-07 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 9.28E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.19E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 5.42E-07 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.98E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.66E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.79E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 4.78E-06 4.74E-06 mr1615 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.88E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 2.56E-26 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.82E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.27E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 6.30E-08 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021 NA 1.65E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251