Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209414021:

Variant ID: vg1209414021 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9414021
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.22, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

CCCATCCCATCGGAGGGTCATTCAGAGAGCAGCCATTGCAAATCTCTGCCCATTTATGAAGGGATGACAGGGTGATTTCCGAGGTCAGACGAGTGAGGAC[A/G]
CCTTGCCACACTCAAGAACAAGCTGTGTTTTAGCTTCCAAGAGAAGGCGAGCCAAGTTTTGGTGAAGGGAGGATGGGTCCCCACCCAAAAGAAAAATAGG

Reverse complement sequence

CCTATTTTTCTTTTGGGTGGGGACCCATCCTCCCTTCACCAAAACTTGGCTCGCCTTCTCTTGGAAGCTAAAACACAGCTTGTTCTTGAGTGTGGCAAGG[T/C]
GTCCTCACTCGTCTGACCTCGGAAATCACCCTGTCATCCCTTCATAAATGGGCAGAGATTTGCAATGGCTGCTCTCTGAATGACCCTCCGATGGGATGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.90%	0.50%	10.66%	47.99%	NA
All Indica	2759	22.70%	0.60%	14.57%	62.16%	NA
All Japonica	1512	80.90%	0.00%	3.31%	15.81%	NA
Aus	269	5.90%	1.10%	8.55%	84.39%	NA
Indica I	595	24.50%	0.50%	8.74%	66.22%	NA
Indica II	465	26.90%	0.60%	20.00%	52.47%	NA
Indica III	913	21.20%	0.40%	15.01%	63.31%	NA
Indica Intermediate	786	20.40%	0.90%	15.27%	63.49%	NA
Temperate Japonica	767	87.70%	0.00%	3.65%	8.60%	NA
Tropical Japonica	504	75.00%	0.00%	2.38%	22.62%	NA
Japonica Intermediate	241	71.40%	0.00%	4.15%	24.48%	NA
VI/Aromatic	96	24.00%	0.00%	19.79%	56.25%	NA
Intermediate	90	50.00%	2.20%	11.11%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209414021	A -> DEL	N	N	silent_mutation	Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1209414021	A -> G	LOC_Os12g16430.1	upstream_gene_variant ; 2177.0bp to feature; MODIFIER	silent_mutation	Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1209414021	A -> G	LOC_Os12g16440.1	upstream_gene_variant ; 540.0bp to feature; MODIFIER	silent_mutation	Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1209414021	A -> G	LOC_Os12g16450.1	upstream_gene_variant ; 4153.0bp to feature; MODIFIER	silent_mutation	Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N
vg1209414021	A -> G	LOC_Os12g16430-LOC_Os12g16440	intergenic_region ; MODIFIER	silent_mutation	Average:37.793; most accessible tissue: Minghui63 young leaf, score: 61.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209414021	NA	1.04E-11	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	5.77E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	6.57E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	4.10E-06	mr1170	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	9.83E-07	mr1177	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	7.50E-13	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	7.44E-06	mr1332	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	5.76E-07	mr1338	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	9.28E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.19E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	5.42E-07	mr1489	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.98E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.66E-10	mr1491	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.79E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	4.78E-06	4.74E-06	mr1615	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.88E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	2.56E-26	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.82E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.27E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	6.30E-08	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209414021	NA	1.65E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251