\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209371154:

Variant ID: vg1209371154 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9371154
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTCAGCCCGTGAGTAAATAAATCACTGCCGGTCAGATATTATTCACCTCCACACTACATTACCAATTAACTTGTATTCACCAGTCAACCAAGCTACC[A/G]
GTTAACATTCTAGCCTCTATTAACAATATTTTCTTTTACACACGGGTTCTGTTACATTCAGACACACTCAGGGGCGTGCCTACGTTATACTACCCGGTGT

Reverse complement sequence

ACACCGGGTAGTATAACGTAGGCACGCCCCTGAGTGTGTCTGAATGTAACAGAACCCGTGTGTAAAAGAAAATATTGTTAATAGAGGCTAGAATGTTAAC[T/C]
GGTAGCTTGGTTGACTGGTGAATACAAGTTAATTGGTAATGTAGTGTGGAGGTGAATAATATCTGACCGGCAGTGATTTATTTACTCACGGGCTGACATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 25.90% 1.12% 7.38% NA
All Indica  2759 52.40% 35.20% 1.52% 10.95% NA
All Japonica  1512 87.00% 12.70% 0.07% 0.20% NA
Aus  269 79.90% 1.50% 2.97% 15.61% NA
Indica I  595 33.10% 66.10% 0.17% 0.67% NA
Indica II  465 55.30% 14.40% 2.37% 27.96% NA
Indica III  913 62.50% 27.60% 0.77% 9.09% NA
Indica Intermediate  786 53.40% 32.80% 2.93% 10.81% NA
Temperate Japonica  767 96.60% 3.00% 0.13% 0.26% NA
Tropical Japonica  504 78.80% 21.20% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 25.70% 0.00% 0.41% NA
VI/Aromatic  96 60.40% 38.50% 0.00% 1.04% NA
Intermediate  90 74.40% 22.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209371154 A -> DEL N N silent_mutation Average:78.486; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N
vg1209371154 A -> G LOC_Os12g16360.1 upstream_gene_variant ; 3784.0bp to feature; MODIFIER silent_mutation Average:78.486; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N
vg1209371154 A -> G LOC_Os12g16350-LOC_Os12g16360 intergenic_region ; MODIFIER silent_mutation Average:78.486; most accessible tissue: Minghui63 panicle, score: 91.41 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209371154 A G 0.01 0.01 0.01 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209371154 NA 6.36E-08 mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 9.54E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 2.87E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 7.64E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 3.46E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 2.03E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 1.76E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 9.73E-06 mr1158 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 1.44E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 2.53E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 6.86E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 5.38E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 6.06E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 1.93E-06 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 3.32E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209371154 NA 3.30E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251