\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209367960:

Variant ID: vg1209367960 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9367960
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTGCAACTGTACTACTGTTTGCCAAAAGGAAAATTTCACATTGAAGGCCCGTTTAAACCCCAGGCAAAATTTTTTACCCTGTCACATCGAATGTTTGA[C/A]
ACATGCATGGAGTATTAAATATAGGGAAAAAAACTAATTGCATATATTACGTGTAAATTGCGAGACGAATCTTTTAAGGCTAATTGCTCCATGATCTGAC

Reverse complement sequence

GTCAGATCATGGAGCAATTAGCCTTAAAAGATTCGTCTCGCAATTTACACGTAATATATGCAATTAGTTTTTTTCCCTATATTTAATACTCCATGCATGT[G/T]
TCAAACATTCGATGTGACAGGGTAAAAAATTTTGCCTGGGGTTTAAACGGGCCTTCAATGTGAAATTTTCCTTTTGGCAAACAGTAGTACAGTTGCAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 27.40% 0.15% 0.00% NA
All Indica  2759 62.30% 37.50% 0.18% 0.00% NA
All Japonica  1512 87.10% 12.90% 0.00% 0.00% NA
Aus  269 95.90% 3.30% 0.74% 0.00% NA
Indica I  595 28.10% 71.60% 0.34% 0.00% NA
Indica II  465 85.80% 14.00% 0.22% 0.00% NA
Indica III  913 70.20% 29.70% 0.11% 0.00% NA
Indica Intermediate  786 65.30% 34.60% 0.13% 0.00% NA
Temperate Japonica  767 96.70% 3.30% 0.00% 0.00% NA
Tropical Japonica  504 78.80% 21.20% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209367960 C -> A LOC_Os12g16350.1 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.8 downstream_gene_variant ; 2379.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.9 downstream_gene_variant ; 2379.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.10 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.11 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.14 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.4 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.7 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.5 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.15 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.13 downstream_gene_variant ; 4058.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350.12 downstream_gene_variant ; 2376.0bp to feature; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg1209367960 C -> A LOC_Os12g16350-LOC_Os12g16360 intergenic_region ; MODIFIER silent_mutation Average:75.259; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209367960 C A -0.01 -0.01 -0.01 -0.04 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209367960 NA 1.77E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 4.96E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 4.79E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 3.76E-07 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 6.03E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 5.49E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 1.81E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 1.69E-13 mr1149 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 2.79E-07 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 5.17E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 5.54E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 3.65E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 5.02E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 2.65E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 5.16E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 1.97E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 1.44E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 4.13E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 4.13E-07 mr1864 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 1.22E-06 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209367960 NA 6.06E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251