| Variant ID: vg1209341359 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 9341359 |
| Reference Allele: G | Alternative Allele: GC,T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )
TGAGCAGCAAGAAGGAGAATTGGCTATGGAATATATTCAAAGATTTCGTAATGTCCGCAGCCGATGTTATGGTTTGAGCCTAAGTGATGAGAAACTAGCA[G/GC,T,A]
ATCTCGGATTCCAAGGATTATCAGCATCTATAAGAGAGATTCTTTTGCCACAAGTTTGGCAGCCTGGCTCATCTAATGCAAAAAGTCCTAGCTCATGAAA
TTTCATGAGCTAGGACTTTTTGCATTAGATGAGCCAGGCTGCCAAACTTGTGGCAAAAGAATCTCTCTTATAGATGCTGATAATCCTTGGAATCCGAGAT[C/GC,A,T]
TGCTAGTTTCTCATCACTTAGGCTCAAACCATAACATCGGCTGCGGACATTACGAAATCTTTGAATATATTCCATAGCCAATTCTCCTTCTTGCTGCTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 4.90% | 1.71% | 1.08% | GC: 0.08% |
| All Indica | 2759 | 97.10% | 0.20% | 0.80% | 1.81% | GC: 0.14% |
| All Japonica | 1512 | 81.50% | 14.70% | 3.70% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.50% | 0.40% | 2.15% | 6.67% | GC: 0.22% |
| Indica III | 913 | 98.40% | 0.00% | 0.44% | 0.99% | GC: 0.22% |
| Indica Intermediate | 786 | 97.50% | 0.30% | 0.89% | 1.27% | GC: 0.13% |
| Temperate Japonica | 767 | 92.00% | 3.10% | 4.69% | 0.13% | NA |
| Tropical Japonica | 504 | 61.70% | 35.70% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 7.50% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209341359 | G -> GC | LOC_Os12g16340.1 | upstream_gene_variant ; 2753.0bp to feature; MODIFIER | silent_mutation | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> GC | LOC_Os12g16330.1 | downstream_gene_variant ; 273.0bp to feature; MODIFIER | silent_mutation | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> GC | LOC_Os12g16330-LOC_Os12g16340 | intergenic_region ; MODIFIER | silent_mutation | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> A | LOC_Os12g16340.1 | upstream_gene_variant ; 2754.0bp to feature; MODIFIER | N | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> A | LOC_Os12g16330.1 | downstream_gene_variant ; 272.0bp to feature; MODIFIER | N | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> A | LOC_Os12g16330-LOC_Os12g16340 | intergenic_region ; MODIFIER | N | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> DEL | N | N | silent_mutation | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> T | LOC_Os12g16340.1 | upstream_gene_variant ; 2754.0bp to feature; MODIFIER | silent_mutation | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> T | LOC_Os12g16330.1 | downstream_gene_variant ; 272.0bp to feature; MODIFIER | silent_mutation | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| vg1209341359 | G -> T | LOC_Os12g16330-LOC_Os12g16340 | intergenic_region ; MODIFIER | silent_mutation | Average:34.198; most accessible tissue: Zhenshan97 young leaf, score: 43.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209341359 | NA | 6.67E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209341359 | 2.37E-06 | 2.37E-06 | mr1207 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209341359 | NA | 9.00E-06 | mr1215 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209341359 | 4.06E-06 | 1.76E-08 | mr1218 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209341359 | NA | 5.16E-09 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209341359 | NA | 4.68E-07 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209341359 | NA | 7.14E-07 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |