| Variant ID: vg1209284803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9284803 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 105. )
GCTTGGATGAATCATGTTCTGTAAAAGATGTTGATCAAAGGCCTTTGGTCGCCCATATCAATGGGATCACACGCATTGCTAAAACTATCTTCAACACAAA[G/C]
AGCTTCTATCGAATAAGTGTTGTAACTACAAAAGTAAATGCAAAATTTGCTACAGGACACTCAAAGATTGTGGCATTTGCTGTGAGACACCCAAAAATTG
CAATTTTTGGGTGTCTCACAGCAAATGCCACAATCTTTGAGTGTCCTGTAGCAAATTTTGCATTTACTTTTGTAGTTACAACACTTATTCGATAGAAGCT[C/G]
TTTGTGTTGAAGATAGTTTTAGCAATGCGTGTGATCCCATTGATATGGGCGACCAAAGGCCTTTGATCAACATCTTTTACAGAACATGATTCATCCAAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 12.20% | 87.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.80% | 0.67% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.70% | 89.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 10.50% | 89.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.30% | 79.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 20.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209284803 | G -> C | LOC_Os12g16220.2 | upstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:42.784; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg1209284803 | G -> C | LOC_Os12g16230.1 | upstream_gene_variant ; 214.0bp to feature; MODIFIER | silent_mutation | Average:42.784; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg1209284803 | G -> C | LOC_Os12g16220.3 | upstream_gene_variant ; 1263.0bp to feature; MODIFIER | silent_mutation | Average:42.784; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg1209284803 | G -> C | LOC_Os12g16240.1 | downstream_gene_variant ; 2102.0bp to feature; MODIFIER | silent_mutation | Average:42.784; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| vg1209284803 | G -> C | LOC_Os12g16220-LOC_Os12g16230 | intergenic_region ; MODIFIER | silent_mutation | Average:42.784; most accessible tissue: Minghui63 flag leaf, score: 70.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209284803 | NA | 4.32E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1209284803 | NA | 7.53E-57 | mr1016 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | 7.40E-11 | 3.48E-44 | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | NA | 3.93E-42 | mr1017 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | 1.89E-09 | 3.22E-39 | mr1017 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | 7.91E-07 | 1.69E-09 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | NA | 3.68E-37 | mr1022 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | 3.35E-14 | 4.37E-45 | mr1022 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | NA | 4.60E-62 | mr1023 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209284803 | 1.97E-08 | 2.04E-31 | mr1023 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/