Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209271838:

Variant ID: vg1209271838 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9271838
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACTAAGAGACCACTATTGACAACCATTGTATATGCCCTTAGCGCTAATTACGGATATATGAACATACTCCCTTCGTCCCAAATATAGTAACTAGAACCG[G/A]
ATGGGACTTATTCTAGTAATATGAATTTGGGCATGCCCCTTGTCAGATTTATAGTACTAGGATGTGTCCCATCCAGTCCTAGGTTGCTATATTCTGAGAT

Reverse complement sequence

ATCTCAGAATATAGCAACCTAGGACTGGATGGGACACATCCTAGTACTATAAATCTGACAAGGGGCATGCCCAAATTCATATTACTAGAATAAGTCCCAT[C/T]
CGGTTCTAGTTACTATATTTGGGACGAAGGGAGTATGTTCATATATCCGTAATTAGCGCTAAGGGCATATACAATGGTTGTCAATAGTGGTCTCTTAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	5.20%	1.82%	0.00%	NA
All Indica	2759	99.50%	0.40%	0.18%	0.00%	NA
All Japonica	1512	79.90%	14.90%	5.22%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.30%	1.30%	0.43%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.30%	0.38%	0.00%	NA
Temperate Japonica	767	65.70%	24.90%	9.39%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.79%	0.00%	NA
Japonica Intermediate	241	84.60%	14.10%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	11.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209271838	G -> A	LOC_Os12g16200.1	upstream_gene_variant ; 4858.0bp to feature; MODIFIER	silent_mutation	Average:62.815; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg1209271838	G -> A	LOC_Os12g16210.1	downstream_gene_variant ; 2253.0bp to feature; MODIFIER	silent_mutation	Average:62.815; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N
vg1209271838	G -> A	LOC_Os12g16200-LOC_Os12g16210	intergenic_region ; MODIFIER	silent_mutation	Average:62.815; most accessible tissue: Zhenshan97 root, score: 78.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209271838	7.20E-06	7.84E-12	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	4.27E-09	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	7.73E-09	3.82E-14	mr1013	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	3.80E-08	7.23E-11	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	2.30E-06	9.13E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	4.57E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	3.06E-07	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	4.27E-07	7.81E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	3.96E-08	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	3.62E-06	NA	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	3.76E-09	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	1.90E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	3.64E-12	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	2.45E-08	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	6.82E-10	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	2.30E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	9.66E-07	5.39E-17	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209271838	NA	1.03E-08	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251