Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209270443:

Variant ID: vg1209270443 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9270443
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGACAATGTGGTGCTACAGTAAACATTTGCTAATGATGGATTAATTAGGCTTAATAGATTCGTCTCGCAATTTACATGCAGAATCTGTAATTTGTTTT[G/A]
TTACTAGTCTATATTTAATAATTCAAATGTGTGATCGTATACATAAAAAAAAATTTATCAAAACAACTAAACACGGCCTAAGTATGGGTATTTGGGCACA

Reverse complement sequence

TGTGCCCAAATACCCATACTTAGGCCGTGTTTAGTTGTTTTGATAAATTTTTTTTTATGTATACGATCACACATTTGAATTATTAAATATAGACTAGTAA[C/T]
AAAACAAATTACAGATTCTGCATGTAAATTGCGAGACGAATCTATTAAGCCTAATTAATCCATCATTAGCAAATGTTTACTGTAGCACCACATTGTCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 5.30% 1.82% 0.00% NA
All Indica  2759 99.20% 0.60% 0.18% 0.00% NA
All Japonica  1512 79.90% 14.90% 5.22% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.30% 0.43% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.30% 0.38% 0.00% NA
Temperate Japonica  767 65.70% 24.90% 9.39% 0.00% NA
Tropical Japonica  504 99.20% 0.00% 0.79% 0.00% NA
Japonica Intermediate  241 84.60% 14.10% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209270443 G -> A LOC_Os12g16200.1 upstream_gene_variant ; 3463.0bp to feature; MODIFIER silent_mutation Average:69.109; most accessible tissue: Minghui63 root, score: 86.528 N N N N
vg1209270443 G -> A LOC_Os12g16210.1 downstream_gene_variant ; 3648.0bp to feature; MODIFIER silent_mutation Average:69.109; most accessible tissue: Minghui63 root, score: 86.528 N N N N
vg1209270443 G -> A LOC_Os12g16200-LOC_Os12g16210 intergenic_region ; MODIFIER silent_mutation Average:69.109; most accessible tissue: Minghui63 root, score: 86.528 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1209270443 G A 0.02 0.02 0.02 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209270443 NA 2.37E-11 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 4.27E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 1.10E-08 4.80E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 3.80E-08 7.23E-11 mr1013 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 1.36E-06 5.34E-13 mr1031 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 4.57E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 3.06E-07 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 1.92E-07 3.15E-14 mr1056 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 3.96E-08 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 5.36E-06 NA mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 3.76E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 3.26E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 2.45E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 6.82E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 1.00E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 2.30E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 6.53E-07 3.37E-17 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209270443 NA 1.03E-08 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251