\
| Variant ID: vg1209244804 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9244804 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATATTATATATTAAAAGTCTACTCCTAAGAACGCTCCTAAGCTGCCACGTGTCATCCTACAAACGCTCATAGGCCGTTACGTGGCATTCTACAATCCCAT[C/T]
GTCGATTTTCATTTAAACTGTTGCACCCATTAGATTATATCTATTTTAAAAGTTCATCATCGATATTTATTTAAATTGATGGACCTGTTATTTTAGAACG
CGTTCTAAAATAACAGGTCCATCAATTTAAATAAATATCGATGATGAACTTTTAAAATAGATATAATCTAATGGGTGCAACAGTTTAAATGAAAATCGAC[G/A]
ATGGGATTGTAGAATGCCACGTAACGGCCTATGAGCGTTTGTAGGATGACACGTGGCAGCTTAGGAGCGTTCTTAGGAGTAGACTTTTAATATATAATAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 0.40% | 1.06% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 95.80% | 1.10% | 3.11% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 2.10% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209244804 | C -> T | LOC_Os12g16180.1 | upstream_gene_variant ; 1815.0bp to feature; MODIFIER | silent_mutation | Average:41.837; most accessible tissue: Callus, score: 61.971 | N | N | N | N |
| vg1209244804 | C -> T | LOC_Os12g16170-LOC_Os12g16180 | intergenic_region ; MODIFIER | silent_mutation | Average:41.837; most accessible tissue: Callus, score: 61.971 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209244804 | NA | 1.54E-07 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | 3.27E-06 | 3.27E-06 | mr1369 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 1.41E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 6.46E-08 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 5.61E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | 5.74E-06 | 5.74E-06 | mr1915 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | 4.54E-06 | 4.54E-06 | mr1081_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 8.87E-06 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 8.00E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 8.48E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 6.49E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209244804 | NA | 2.26E-06 | mr1874_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |