\
| Variant ID: vg1209239750 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9239750 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.39, others allele: 0.00, population size: 103. )
GCAGCTCAACTGGGGTATAAGCCAAACGTCTTCTCCTTCTGGATCCTTTTACTTCAACTAAGGTTGATTGATTATTGCAAGAATGAGCATATGACATACT[T/C]
AACAAGCCACACAGCAAATATGCAAGTGCACAAGGATACCAAAGGATGGCATAATATAGGCTCATTTGCAAAAGCAGCATTTAGCAAACATTTAAGAGTA
TACTCTTAAATGTTTGCTAAATGCTGCTTTTGCAAATGAGCCTATATTATGCCATCCTTTGGTATCCTTGTGCACTTGCATATTTGCTGTGTGGCTTGTT[A/G]
AGTATGTCATATGCTCATTCTTGCAATAATCAATCAACCTTAGTTGAAGTAAAAGGATCCAGAAGGAGAAGACGTTTGGCTTATACCCCAGTTGAGCTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 34.40% | 0.87% | 0.00% | NA |
| All Indica | 2759 | 94.50% | 4.20% | 1.23% | 0.00% | NA |
| All Japonica | 1512 | 5.40% | 94.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.30% | 1.60% | 1.10% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 4.60% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 6.00% | 94.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 93.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 54.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209239750 | T -> C | LOC_Os12g16170.1 | downstream_gene_variant ; 1960.0bp to feature; MODIFIER | silent_mutation | Average:54.184; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg1209239750 | T -> C | LOC_Os12g16170-LOC_Os12g16180 | intergenic_region ; MODIFIER | silent_mutation | Average:54.184; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209239750 | NA | 5.32E-09 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 2.77E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 3.71E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 5.90E-09 | mr1546 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 3.34E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 2.35E-06 | mr1743 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 2.07E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 1.16E-14 | mr1178_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 2.76E-08 | mr1489_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | 1.93E-06 | 8.76E-08 | mr1521_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209239750 | NA | 4.50E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |