\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209239750:

Variant ID: vg1209239750 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9239750
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.60, C: 0.39, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGCTCAACTGGGGTATAAGCCAAACGTCTTCTCCTTCTGGATCCTTTTACTTCAACTAAGGTTGATTGATTATTGCAAGAATGAGCATATGACATACT[T/C]
AACAAGCCACACAGCAAATATGCAAGTGCACAAGGATACCAAAGGATGGCATAATATAGGCTCATTTGCAAAAGCAGCATTTAGCAAACATTTAAGAGTA

Reverse complement sequence

TACTCTTAAATGTTTGCTAAATGCTGCTTTTGCAAATGAGCCTATATTATGCCATCCTTTGGTATCCTTGTGCACTTGCATATTTGCTGTGTGGCTTGTT[A/G]
AGTATGTCATATGCTCATTCTTGCAATAATCAATCAACCTTAGTTGAAGTAAAAGGATCCAGAAGGAGAAGACGTTTGGCTTATACCCCAGTTGAGCTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 34.40% 0.87% 0.00% NA
All Indica  2759 94.50% 4.20% 1.23% 0.00% NA
All Japonica  1512 5.40% 94.50% 0.07% 0.00% NA
Aus  269 96.30% 3.00% 0.74% 0.00% NA
Indica I  595 97.10% 2.00% 0.84% 0.00% NA
Indica II  465 88.20% 11.60% 0.22% 0.00% NA
Indica III  913 97.30% 1.60% 1.10% 0.00% NA
Indica Intermediate  786 93.10% 4.60% 2.29% 0.00% NA
Temperate Japonica  767 6.00% 94.00% 0.00% 0.00% NA
Tropical Japonica  504 6.00% 93.80% 0.20% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 41.10% 54.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209239750 T -> C LOC_Os12g16170.1 downstream_gene_variant ; 1960.0bp to feature; MODIFIER silent_mutation Average:54.184; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg1209239750 T -> C LOC_Os12g16170-LOC_Os12g16180 intergenic_region ; MODIFIER silent_mutation Average:54.184; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209239750 NA 5.32E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 2.77E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 3.71E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 5.90E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 3.34E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 2.35E-06 mr1743 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 2.07E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 1.16E-14 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 2.76E-08 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 1.93E-06 8.76E-08 mr1521_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209239750 NA 4.50E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251