Search for Variation information by Variation ID:
Detailed information for vg1209224752:
| Variant ID: vg1209224752 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9224752 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 281. )
Flanking Sequence (100 bp) in Reference Genome:
GATGTCACTGCACCCAGGGCAGTTTTTAATAGATGGCAGCCTCATACCTTCATTCCAGCAGAATCTAAAGAACTCACAACCCCAATGAGGATCAAAACCA[C/T]
CATCGTATTCTTCATGATGCTTCTCCTGCTGCTTGTCATACTTCCTCTGATATTTGTTAATAACCTTAGCTGAATTCACCTGAAAACCTCTTGCACGGAC
Reverse complement sequence
GTCCGTGCAAGAGGTTTTCAGGTGAATTCAGCTAAGGTTATTAACAAATATCAGAGGAAGTATGACAAGCAGCAGGAGAAGCATCATGAAGAATACGATG[G/A]
TGGTTTTGATCCTCATTGGGGTTGTGAGTTCTTTAGATTCTGCTGGAATGAAGGTATGAGGCTGCCATCTATTAAAAACTGCCCTGGGTGCAGTGACATC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.40% | 33.20% | 1.16% | 31.21% | NA |
| All Indica | 2759 | 4.60% | 43.60% | 1.85% | 49.95% | NA |
| All Japonica | 1512 | 94.20% | 2.10% | 0.13% | 3.51% | NA |
| Aus | 269 | 1.50% | 97.80% | 0.00% | 0.74% | NA |
| Indica I | 595 | 3.00% | 54.50% | 0.67% | 41.85% | NA |
| Indica II | 465 | 12.00% | 41.30% | 1.51% | 45.16% | NA |
| Indica III | 913 | 1.90% | 36.10% | 3.18% | 58.82% | NA |
| Indica Intermediate | 786 | 4.60% | 45.40% | 1.40% | 48.60% | NA |
| Temperate Japonica | 767 | 93.40% | 1.60% | 0.13% | 4.95% | NA |
| Tropical Japonica | 504 | 94.00% | 2.80% | 0.20% | 2.98% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 42.70% | 1.04% | 31.25% | NA |
| Intermediate | 90 | 53.30% | 32.20% | 1.11% | 13.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209224752 | C -> DEL | LOC_Os12g16150.1 | N | frameshift_variant | Average:37.173; most accessible tissue: Zhenshan97 young leaf, score: 60.208 | N | N | N | N |
| vg1209224752 | C -> T | LOC_Os12g16150.1 | missense_variant ; p.Gly365Asp; MODERATE | nonsynonymous_codon ; G365D | Average:37.173; most accessible tissue: Zhenshan97 young leaf, score: 60.208 | benign  |
-0.127 |
TOLERATED | 0.98 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209224752 | NA | 5.75E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 3.31E-07 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 2.54E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 6.22E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 1.51E-08 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 2.43E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 1.44E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | 8.40E-06 | 3.23E-06 | mr1737 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 2.56E-06 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | NA | 2.55E-08 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209224752 | 4.00E-06 | NA | mr1804 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |