Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209218924:

Variant ID: vg1209218924 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9218924
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTGGTGAAGATGTTGACCAGGCTGTAGCCGAAATGAGTGACACAGAAAGAACACCATCGGCTTCACCCAAGCAAACGCCTCCAACTCCTTCTGCCCC[C/T]
GTTCATTTTACAAGAGTAAGTATCTCTCTTTGACTTCTTCTGAAATTACCTCCCTCTTCGGCTAAATACTCATAGACTTTGTGGTTGTAGAAGAAGAAAA

Reverse complement sequence

TTTTCTTCTTCTACAACCACAAAGTCTATGAGTATTTAGCCGAAGAGGGAGGTAATTTCAGAAGAAGTCAAAGAGAGATACTTACTCTTGTAAAATGAAC[G/A]
GGGGCAGAAGGAGTTGGAGGCGTTTGCTTGGGTGAAGCCGATGGTGTTCTTTCTGTGTCACTCATTTCGGCTACAGCCTGGTCAACATCTTCACCAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	8.00%	2.67%	25.94%	NA
All Indica	2759	55.30%	2.20%	1.30%	41.21%	NA
All Japonica	1512	71.10%	20.20%	5.42%	3.24%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	60.80%	0.50%	2.18%	36.47%	NA
Indica II	465	49.20%	9.00%	1.08%	40.65%	NA
Indica III	913	53.90%	0.30%	0.66%	45.13%	NA
Indica Intermediate	786	56.40%	1.50%	1.53%	40.59%	NA
Temperate Japonica	767	86.40%	2.10%	7.04%	4.43%	NA
Tropical Japonica	504	51.80%	41.70%	3.57%	2.98%	NA
Japonica Intermediate	241	62.70%	33.20%	4.15%	0.00%	NA
VI/Aromatic	96	62.50%	3.10%	3.12%	31.25%	NA
Intermediate	90	71.10%	12.20%	5.56%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209218924	C -> DEL	LOC_Os12g16140.1	N	frameshift_variant	Average:32.322; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg1209218924	C -> T	LOC_Os12g16140.1	synonymous_variant ; p.Pro507Pro; LOW	synonymous_codon	Average:32.322; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209218924	NA	9.05E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	NA	8.73E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	5.01E-08	NA	mr1117	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	1.81E-06	7.75E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	6.27E-08	NA	mr1119	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	7.99E-07	2.05E-09	mr1119	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	9.91E-07	6.24E-08	mr1120	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	2.23E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	9.75E-06	1.02E-06	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	3.42E-07	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	NA	4.96E-07	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	4.74E-08	NA	mr1546	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	NA	6.06E-06	mr1697	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	9.80E-06	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	NA	1.68E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	1.30E-08	NA	mr1117_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	7.24E-07	5.75E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	9.96E-08	NA	mr1119_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	6.25E-07	3.18E-08	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	1.45E-06	NA	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	5.23E-07	NA	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	2.93E-06	3.11E-06	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	1.93E-06	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	2.19E-06	NA	mr1961_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209218924	3.66E-06	4.89E-06	mr1961_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251