Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1209215198:

Variant ID: vg1209215198 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9215198
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAAGCTCGCCTTCGGGTGTGTTAGCGTGCTAGTTGATTTGATCCTGCAATCAACAAGAAATAGAAACAAAGAGACCGCGGTTAAATCTATAAATGATAG[C/T]
CGATCGGCTAGGTGCCGATGACATATCATTTATCTTTGAGCCGATGTCATATGTGAATCGATCGGCGGTTGTAAATAGACAATAAAGAACTAAATCTATT

Reverse complement sequence

AATAGATTTAGTTCTTTATTGTCTATTTACAACCGCCGATCGATTCACATATGACATCGGCTCAAAGATAAATGATATGTCATCGGCACCTAGCCGATCG[G/A]
CTATCATTTATAGATTTAACCGCGGTCTCTTTGTTTCTATTTCTTGTTGATTGCAGGATCAAATCAACTAGCACGCTAACACACCCGAAGGCGAGCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.90%	2.60%	3.00%	31.55%	NA
All Indica	2759	47.50%	0.90%	3.77%	47.84%	NA
All Japonica	1512	96.10%	0.10%	0.07%	3.70%	NA
Aus	269	41.60%	27.50%	10.04%	20.82%	NA
Indica I	595	53.40%	2.20%	3.53%	40.84%	NA
Indica II	465	54.40%	0.20%	2.15%	43.23%	NA
Indica III	913	38.40%	0.40%	5.04%	56.08%	NA
Indica Intermediate	786	49.40%	0.90%	3.44%	46.31%	NA
Temperate Japonica	767	95.00%	0.00%	0.13%	4.82%	NA
Tropical Japonica	504	96.60%	0.00%	0.00%	3.37%	NA
Japonica Intermediate	241	98.30%	0.80%	0.00%	0.83%	NA
VI/Aromatic	96	31.20%	15.60%	8.33%	44.79%	NA
Intermediate	90	74.40%	5.60%	2.22%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209215198	C -> DEL	N	N	silent_mutation	Average:35.342; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg1209215198	C -> T	LOC_Os12g16140.1	upstream_gene_variant ; 1609.0bp to feature; MODIFIER	silent_mutation	Average:35.342; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg1209215198	C -> T	LOC_Os12g16130.1	downstream_gene_variant ; 3532.0bp to feature; MODIFIER	silent_mutation	Average:35.342; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg1209215198	C -> T	LOC_Os12g16130-LOC_Os12g16140	intergenic_region ; MODIFIER	silent_mutation	Average:35.342; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209215198	1.60E-07	NA	mr1118	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	NA	2.21E-16	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	3.87E-06	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	2.35E-07	NA	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	NA	1.28E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	9.52E-07	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	3.65E-07	2.61E-16	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	4.03E-06	1.17E-18	mr1936	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209215198	NA	1.74E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251