\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209158266:

Variant ID: vg1209158266 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9158266
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAACAATTCTCAGGTTGCGATACCAATCCATGAAGTTTATTCCAGTCAACTTCTCTTTCTCAAGAATAGACCGCAAGTTAAAATTGGATGGTGCAGGAG[C/T]
TGCCATGATCTACAATAGAAATATATGTATGCAAAGTCAGCACCATGTTTACATTTAACCTTTCATTAAACAATTTAACAAAAGATACTCCCACTATGTA

Reverse complement sequence

TACATAGTGGGAGTATCTTTTGTTAAATTGTTTAATGAAAGGTTAAATGTAAACATGGTGCTGACTTTGCATACATATATTTCTATTGTAGATCATGGCA[G/A]
CTCCTGCACCATCCAATTTTAACTTGCGGTCTATTCTTGAGAAAGAGAAGTTGACTGGAATAAACTTCATGGATTGGTATCGCAACCTGAGAATTGTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 0.60% 7.70% 19.47% NA
All Indica  2759 57.80% 0.10% 11.56% 30.55% NA
All Japonica  1512 96.60% 1.70% 0.79% 0.99% NA
Aus  269 78.10% 0.00% 7.81% 14.13% NA
Indica I  595 46.40% 0.30% 8.57% 44.71% NA
Indica II  465 64.50% 0.00% 14.84% 20.65% NA
Indica III  913 62.70% 0.00% 10.51% 26.83% NA
Indica Intermediate  786 56.70% 0.10% 13.10% 30.03% NA
Temperate Japonica  767 95.40% 3.30% 0.39% 0.91% NA
Tropical Japonica  504 97.80% 0.00% 1.19% 0.99% NA
Japonica Intermediate  241 97.50% 0.00% 1.24% 1.24% NA
VI/Aromatic  96 79.20% 0.00% 7.29% 13.54% NA
Intermediate  90 82.20% 0.00% 5.56% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209158266 C -> DEL LOC_Os12g16060.1 N frameshift_variant Average:8.929; most accessible tissue: Callus, score: 26.9 N N N N
vg1209158266 C -> T LOC_Os12g16060.1 missense_variant ; p.Ala66Thr; MODERATE nonsynonymous_codon ; A66T Average:8.929; most accessible tissue: Callus, score: 26.9 unknown unknown TOLERATED 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209158266 NA 5.19E-09 mr1028 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 4.98E-07 4.98E-07 mr1369 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 1.42E-08 mr1453 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 1.08E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 5.48E-09 mr1652 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 4.01E-07 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 5.50E-06 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 9.50E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 2.02E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 1.72E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 5.64E-06 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209158266 NA 4.77E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251