Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209081295:

Variant ID: vg1209081295 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9081295
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.42, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTAGCTGGTGGAATAGAATTAGAATAGGAATCAGGAGTCCGGAAGTCTTCGGAAGAGTTCGGGTATGGCTCTGGTAGCTTTCCTTTCCTCTTTTGTAA[A/G]
CTTTGTACTTTTATTAGAATACTCTTCTAAATACATTTCTGGTATTGAAATACTTTCCGAGTATATTAGTACCAACTTTACATTATGTTCTTGTTATACT

Reverse complement sequence

AGTATAACAAGAACATAATGTAAAGTTGGTACTAATATACTCGGAAAGTATTTCAATACCAGAAATGTATTTAGAAGAGTATTCTAATAAAAGTACAAAG[T/C]
TTACAAAAGAGGAAAGGAAAGCTACCAGAGCCATACCCGAACTCTTCCGAAGACTTCCGGACTCCTGATTCCTATTCTAATTCTATTCCACCAGCTAGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	33.40%	1.52%	0.04%	NA
All Indica	2759	95.50%	2.60%	1.74%	0.07%	NA
All Japonica	1512	5.80%	94.20%	0.00%	0.00%	NA
Aus	269	87.70%	4.10%	8.18%	0.00%	NA
Indica I	595	93.30%	2.00%	4.71%	0.00%	NA
Indica II	465	94.40%	4.10%	1.29%	0.22%	NA
Indica III	913	97.70%	1.80%	0.44%	0.11%	NA
Indica Intermediate	786	95.40%	3.30%	1.27%	0.00%	NA
Temperate Japonica	767	7.70%	92.30%	0.00%	0.00%	NA
Tropical Japonica	504	4.40%	95.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	22.90%	1.04%	0.00%	NA
Intermediate	90	44.40%	54.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209081295	A -> DEL	N	N	silent_mutation	Average:46.199; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1209081295	A -> G	LOC_Os12g15930.1	upstream_gene_variant ; 2150.0bp to feature; MODIFIER	silent_mutation	Average:46.199; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1209081295	A -> G	LOC_Os12g15920.1	downstream_gene_variant ; 4178.0bp to feature; MODIFIER	silent_mutation	Average:46.199; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N
vg1209081295	A -> G	LOC_Os12g15920-LOC_Os12g15930	intergenic_region ; MODIFIER	silent_mutation	Average:46.199; most accessible tissue: Zhenshan97 flag leaf, score: 61.322	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209081295	NA	1.19E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209081295	NA	5.86E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209081295	NA	1.50E-38	mr1719	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209081295	2.12E-06	NA	mr1750	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209081295	NA	8.43E-08	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209081295	7.84E-06	7.84E-06	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251