\
| Variant ID: vg1209054055 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9054055 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 54. )
ACAACTCCTCCTCGATATACATGAAGGCATCTGTGGGTCACATGCCGTCGGTCGCACATTGGTCGGGAAAGCCTTTCGACAAGGGTTTTTCTGGCCAACC[A/G]
CCCTCAAAGACGCATTTGACATAGTCCAGCGGTGTGAAGCCTGTCAATTCCACAGCAAGCACAGAAAGCTACCTACACAAGCGCTCCAGACCATCCCTCT
AGAGGGATGGTCTGGAGCGCTTGTGTAGGTAGCTTTCTGTGCTTGCTGTGGAATTGACAGGCTTCACACCGCTGGACTATGTCAAATGCGTCTTTGAGGG[T/C]
GGTTGGCCAGAAAAACCCTTGTCGAAAGGCTTTCCCGACCAATGTGCGACCGACGGCATGTGACCCACAGATGCCTTCATGTATATCGAGGAGGAGTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.80% | 36.40% | 0.68% | 11.15% | NA |
| All Indica | 2759 | 74.20% | 6.50% | 0.98% | 18.38% | NA |
| All Japonica | 1512 | 4.50% | 94.40% | 0.13% | 0.93% | NA |
| Aus | 269 | 95.90% | 3.30% | 0.74% | 0.00% | NA |
| Indica I | 595 | 48.40% | 8.40% | 2.02% | 41.18% | NA |
| Indica II | 465 | 65.40% | 7.70% | 1.08% | 25.81% | NA |
| Indica III | 913 | 93.40% | 3.00% | 0.22% | 3.40% | NA |
| Indica Intermediate | 786 | 76.50% | 8.40% | 1.02% | 14.12% | NA |
| Temperate Japonica | 767 | 6.10% | 92.60% | 0.26% | 1.04% | NA |
| Tropical Japonica | 504 | 3.60% | 95.80% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.50% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 42.70% | 54.20% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 40.00% | 55.60% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209054055 | A -> DEL | LOC_Os12g15900.1 | N | frameshift_variant | Average:31.018; most accessible tissue: Minghui63 flag leaf, score: 60.569 | N | N | N | N |
| vg1209054055 | A -> G | LOC_Os12g15900.1 | missense_variant ; p.Thr622Ala; MODERATE | nonsynonymous_codon ; T622V | Average:31.018; most accessible tissue: Minghui63 flag leaf, score: 60.569 | benign |
0.182 |
DELETERIOUS | 0.01 |
| vg1209054055 | A -> G | LOC_Os12g15900.1 | missense_variant ; p.Thr622Ala; MODERATE | nonsynonymous_codon ; T622A | Average:31.018; most accessible tissue: Minghui63 flag leaf, score: 60.569 | benign |
-0.764 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209054055 | NA | 7.61E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 1.19E-08 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 2.64E-19 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 3.76E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 2.21E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 1.55E-12 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 1.63E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 2.54E-12 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | 2.96E-06 | 2.96E-06 | mr1623 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 6.93E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 8.04E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 5.07E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 3.78E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 1.99E-14 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 3.30E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 2.43E-07 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209054055 | NA | 2.76E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |