\
| Variant ID: vg1209051637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9051637 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 61. )
AATCACGCTGCCTATGACTTTCGGCCAAGCAAACAACTTCCGGACAGAGCAGATCACCTTTGATGTCGCTAAATTCGATACAGCGTATAACGCCATCATC[G/A]
GGAGAACTGCACTTGTGAAGTTCATGGCCGCATCTCACTACGCGTATCAAGTGCTCAAGATGCCAGGGCCGAAGGGAACAATCATCATCCAAGGGAACGC
GCGTTCCCTTGGATGATGATTGTTCCCTTCGGCCCTGGCATCTTGAGCACTTGATACGCGTAGTGAGATGCGGCCATGAACTTCACAAGTGCAGTTCTCC[C/T]
GATGATGGCGTTATACGCTGTATCGAATTTAGCGACATCAAAGGTGATCTGCTCTGTCCGGAAGTTGTTTGCTTGGCCGAAAGTCATAGGCAGCGTGATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.20% | 37.20% | 3.43% | 20.21% | NA |
| All Indica | 2759 | 53.50% | 8.60% | 4.97% | 32.95% | NA |
| All Japonica | 1512 | 4.20% | 94.40% | 0.07% | 1.32% | NA |
| Aus | 269 | 80.70% | 5.20% | 7.06% | 7.06% | NA |
| Indica I | 595 | 35.10% | 11.60% | 2.86% | 50.42% | NA |
| Indica II | 465 | 50.80% | 9.90% | 3.87% | 35.48% | NA |
| Indica III | 913 | 65.10% | 5.30% | 6.90% | 22.78% | NA |
| Indica Intermediate | 786 | 55.50% | 9.50% | 4.96% | 30.03% | NA |
| Temperate Japonica | 767 | 5.70% | 92.60% | 0.13% | 1.56% | NA |
| Tropical Japonica | 504 | 3.40% | 95.80% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.10% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 69.80% | 24.00% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 33.30% | 60.00% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209051637 | G -> DEL | LOC_Os12g15890.1 | N | frameshift_variant | Average:27.032; most accessible tissue: Minghui63 young leaf, score: 64.378 | N | N | N | N |
| vg1209051637 | G -> A | LOC_Os12g15890.1 | missense_variant ; p.Gly137Arg; MODERATE | nonsynonymous_codon ; G137K | Average:27.032; most accessible tissue: Minghui63 young leaf, score: 64.378 | probably damaging |
2.091 |
DELETERIOUS | 0.00 |
| vg1209051637 | G -> A | LOC_Os12g15890.1 | missense_variant ; p.Gly137Arg; MODERATE | nonsynonymous_codon ; G137R | Average:27.032; most accessible tissue: Minghui63 young leaf, score: 64.378 | benign |
1.14 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209051637 | NA | 3.51E-08 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 2.89E-07 | mr1237 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 2.58E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 2.99E-08 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 6.69E-08 | mr1425 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 2.90E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 9.42E-06 | mr1851 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 3.18E-07 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 5.52E-08 | mr1540_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 5.28E-07 | mr1732_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209051637 | NA | 1.34E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |