\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209051637:

Variant ID: vg1209051637 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9051637
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


AATCACGCTGCCTATGACTTTCGGCCAAGCAAACAACTTCCGGACAGAGCAGATCACCTTTGATGTCGCTAAATTCGATACAGCGTATAACGCCATCATC[G/A]
GGAGAACTGCACTTGTGAAGTTCATGGCCGCATCTCACTACGCGTATCAAGTGCTCAAGATGCCAGGGCCGAAGGGAACAATCATCATCCAAGGGAACGC

Reverse complement sequence

GCGTTCCCTTGGATGATGATTGTTCCCTTCGGCCCTGGCATCTTGAGCACTTGATACGCGTAGTGAGATGCGGCCATGAACTTCACAAGTGCAGTTCTCC[C/T]
GATGATGGCGTTATACGCTGTATCGAATTTAGCGACATCAAAGGTGATCTGCTCTGTCCGGAAGTTGTTTGCTTGGCCGAAAGTCATAGGCAGCGTGATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 37.20% 3.43% 20.21% NA
All Indica  2759 53.50% 8.60% 4.97% 32.95% NA
All Japonica  1512 4.20% 94.40% 0.07% 1.32% NA
Aus  269 80.70% 5.20% 7.06% 7.06% NA
Indica I  595 35.10% 11.60% 2.86% 50.42% NA
Indica II  465 50.80% 9.90% 3.87% 35.48% NA
Indica III  913 65.10% 5.30% 6.90% 22.78% NA
Indica Intermediate  786 55.50% 9.50% 4.96% 30.03% NA
Temperate Japonica  767 5.70% 92.60% 0.13% 1.56% NA
Tropical Japonica  504 3.40% 95.80% 0.00% 0.79% NA
Japonica Intermediate  241 1.20% 97.10% 0.00% 1.66% NA
VI/Aromatic  96 69.80% 24.00% 2.08% 4.17% NA
Intermediate  90 33.30% 60.00% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209051637 G -> DEL LOC_Os12g15890.1 N frameshift_variant Average:27.032; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg1209051637 G -> A LOC_Os12g15890.1 missense_variant ; p.Gly137Arg; MODERATE nonsynonymous_codon ; G137K Average:27.032; most accessible tissue: Minghui63 young leaf, score: 64.378 probably damaging 2.091 DELETERIOUS 0.00
vg1209051637 G -> A LOC_Os12g15890.1 missense_variant ; p.Gly137Arg; MODERATE nonsynonymous_codon ; G137R Average:27.032; most accessible tissue: Minghui63 young leaf, score: 64.378 benign 1.14 DELETERIOUS 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209051637 NA 3.51E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 2.89E-07 mr1237 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 2.58E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 2.99E-08 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 6.69E-08 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 2.90E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 9.42E-06 mr1851 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 3.18E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 5.52E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 5.28E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209051637 NA 1.34E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251