\
| Variant ID: vg1209050414 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9050414 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 73. )
CGATGGCCTAAGAGGTTCCGACCGGGAGCAGTAGAGAAGTACGATGGGAGCACTGACCCAGAAGAATTTCTTCAAGTCTACTCCACAGTACTCTATGCTG[T/C]
CGGATCGGACGACAACGCGTTGGCGAATTATTTGCCAACTGCGTTAAAAGGCTCTGCGCGTTCATGGTTGATGCACCTTCCGCCCTACTCGATTTCTTCG
CGAAGAAATCGAGTAGGGCGGAAGGTGCATCAACCATGAACGCGCAGAGCCTTTTAACGCAGTTGGCAAATAATTCGCCAACGCGTTGTCGTCCGATCCG[A/G]
CAGCATAGAGTACTGTGGAGTAGACTTGAAGAAATTCTTCTGGGTCAGTGCTCCCATCGTACTTCTCTACTGCTCCCGGTCGGAACCTCTTAGGCCATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.40% | 35.70% | 0.89% | 23.99% | NA |
| All Indica | 2759 | 53.80% | 6.30% | 1.34% | 38.56% | NA |
| All Japonica | 1512 | 4.20% | 94.30% | 0.13% | 1.32% | NA |
| Aus | 269 | 80.70% | 4.10% | 0.00% | 15.24% | NA |
| Indica I | 595 | 35.30% | 10.30% | 1.85% | 52.61% | NA |
| Indica II | 465 | 51.40% | 7.50% | 1.94% | 39.14% | NA |
| Indica III | 913 | 65.30% | 2.20% | 0.77% | 31.76% | NA |
| Indica Intermediate | 786 | 55.70% | 7.50% | 1.27% | 35.50% | NA |
| Temperate Japonica | 767 | 5.70% | 92.40% | 0.26% | 1.56% | NA |
| Tropical Japonica | 504 | 3.40% | 95.80% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.10% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 71.90% | 22.90% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 34.40% | 57.80% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209050414 | T -> C | LOC_Os12g15880.1 | missense_variant ; p.Val433Ala; MODERATE | nonsynonymous_codon ; V433T | Average:26.025; most accessible tissue: Minghui63 young leaf, score: 61.887 | benign |
-0.254 |
TOLERATED | 0.11 |
| vg1209050414 | T -> C | LOC_Os12g15880.1 | missense_variant ; p.Val433Ala; MODERATE | nonsynonymous_codon ; V433A | Average:26.025; most accessible tissue: Minghui63 young leaf, score: 61.887 | benign |
-0.716 |
TOLERATED | 1.00 |
| vg1209050414 | T -> DEL | LOC_Os12g15880.1 | N | frameshift_variant | Average:26.025; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209050414 | NA | 1.24E-08 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | 2.78E-06 | NA | mr1016 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | 4.72E-07 | 1.45E-06 | mr1018 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | 2.05E-06 | NA | mr1132 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | 5.08E-06 | NA | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 6.36E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 2.76E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 1.60E-08 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 2.97E-51 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 6.80E-07 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 6.80E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 8.50E-17 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 2.67E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 8.49E-11 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 7.62E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209050414 | NA | 3.46E-45 | mr1546_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |