\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209049562:

Variant ID: vg1209049562 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 9049562
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATCGACATCGGTTCTTCCGAACCGTTAGTCCTGCACCTACTTGAGGACTACGACTCCTCGTCGACAAGTACGCGACGTGAGGTATTGGCTATCGACG[A/G]
GACAGGCACATTGGCACGCGCTAACACCGGGGCGGAAAATATGACGTCTACACCGGCTCAGCACATCAGGACCCTCAACGCAATACTGAGGGAGACCCCT

Reverse complement sequence

AGGGGTCTCCCTCAGTATTGCGTTGAGGGTCCTGATGTGCTGAGCCGGTGTAGACGTCATATTTTCCGCCCCGGTGTTAGCGCGTGCCAATGTGCCTGTC[T/C]
CGTCGATAGCCAATACCTCACGTCGCGTACTTGTCGACGAGGAGTCGTAGTCCTCAAGTAGGTGCAGGACTAACGGTTCGGAAGAACCGATGTCGATAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 35.40% 1.14% 23.80% NA
All Indica  2759 54.00% 6.00% 1.88% 38.09% NA
All Japonica  1512 4.20% 94.30% 0.07% 1.39% NA
Aus  269 81.00% 3.70% 0.37% 14.87% NA
Indica I  595 35.50% 9.20% 1.51% 53.78% NA
Indica II  465 51.40% 7.30% 3.44% 37.85% NA
Indica III  913 65.40% 2.10% 1.86% 30.67% NA
Indica Intermediate  786 56.40% 7.40% 1.27% 34.99% NA
Temperate Japonica  767 5.70% 92.40% 0.13% 1.69% NA
Tropical Japonica  504 3.40% 95.80% 0.00% 0.79% NA
Japonica Intermediate  241 1.20% 97.10% 0.00% 1.66% NA
VI/Aromatic  96 71.90% 22.90% 0.00% 5.21% NA
Intermediate  90 35.60% 55.60% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1209049562 A -> DEL N N silent_mutation Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg1209049562 A -> G LOC_Os12g15890.1 upstream_gene_variant ; 1667.0bp to feature; MODIFIER silent_mutation Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg1209049562 A -> G LOC_Os12g15900.1 upstream_gene_variant ; 2630.0bp to feature; MODIFIER silent_mutation Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg1209049562 A -> G LOC_Os12g15870.1 downstream_gene_variant ; 2111.0bp to feature; MODIFIER silent_mutation Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N
vg1209049562 A -> G LOC_Os12g15880.1 intron_variant ; MODIFIER silent_mutation Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1209049562 1.04E-06 NA mr1016 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 1.50E-06 3.52E-06 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 5.98E-06 NA mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 5.57E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 9.35E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 2.00E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 1.77E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 3.67E-53 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 1.63E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 3.81E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 2.02E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 3.28E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 6.43E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 3.78E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209049562 NA 3.25E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251