| Variant ID: vg1209049562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9049562 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 61. )
GTTATCGACATCGGTTCTTCCGAACCGTTAGTCCTGCACCTACTTGAGGACTACGACTCCTCGTCGACAAGTACGCGACGTGAGGTATTGGCTATCGACG[A/G]
GACAGGCACATTGGCACGCGCTAACACCGGGGCGGAAAATATGACGTCTACACCGGCTCAGCACATCAGGACCCTCAACGCAATACTGAGGGAGACCCCT
AGGGGTCTCCCTCAGTATTGCGTTGAGGGTCCTGATGTGCTGAGCCGGTGTAGACGTCATATTTTCCGCCCCGGTGTTAGCGCGTGCCAATGTGCCTGTC[T/C]
CGTCGATAGCCAATACCTCACGTCGCGTACTTGTCGACGAGGAGTCGTAGTCCTCAAGTAGGTGCAGGACTAACGGTTCGGAAGAACCGATGTCGATAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.60% | 35.40% | 1.14% | 23.80% | NA |
| All Indica | 2759 | 54.00% | 6.00% | 1.88% | 38.09% | NA |
| All Japonica | 1512 | 4.20% | 94.30% | 0.07% | 1.39% | NA |
| Aus | 269 | 81.00% | 3.70% | 0.37% | 14.87% | NA |
| Indica I | 595 | 35.50% | 9.20% | 1.51% | 53.78% | NA |
| Indica II | 465 | 51.40% | 7.30% | 3.44% | 37.85% | NA |
| Indica III | 913 | 65.40% | 2.10% | 1.86% | 30.67% | NA |
| Indica Intermediate | 786 | 56.40% | 7.40% | 1.27% | 34.99% | NA |
| Temperate Japonica | 767 | 5.70% | 92.40% | 0.13% | 1.69% | NA |
| Tropical Japonica | 504 | 3.40% | 95.80% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 1.20% | 97.10% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 71.90% | 22.90% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 35.60% | 55.60% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209049562 | A -> DEL | N | N | silent_mutation | Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| vg1209049562 | A -> G | LOC_Os12g15890.1 | upstream_gene_variant ; 1667.0bp to feature; MODIFIER | silent_mutation | Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| vg1209049562 | A -> G | LOC_Os12g15900.1 | upstream_gene_variant ; 2630.0bp to feature; MODIFIER | silent_mutation | Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| vg1209049562 | A -> G | LOC_Os12g15870.1 | downstream_gene_variant ; 2111.0bp to feature; MODIFIER | silent_mutation | Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| vg1209049562 | A -> G | LOC_Os12g15880.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.942; most accessible tissue: Minghui63 young leaf, score: 79.549 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209049562 | 1.04E-06 | NA | mr1016 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | 1.50E-06 | 3.52E-06 | mr1018 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | 5.98E-06 | NA | mr1132 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | NA | 5.57E-19 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | NA | 9.35E-06 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | NA | 2.00E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | NA | 1.77E-08 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | NA | 3.67E-53 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | NA | 1.63E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209049562 | NA | 3.81E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/