Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209042641:

Variant ID: vg1209042641 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9042641
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:

AAGACACATCTTCCTCACGTGCAACCACGTGCCACATACCACCACGGTATACAGACGGAAGACGTGACATAGTTTCCAACCTATCCTAGCCATAGACAAG[A/T]
GTACCGACCCAATTCCACCTACGGCCGGAACCCCCGGGACAGGCAGGCAGGACTGAGCCCCTAGCAGCAGGACACCGGCCCTGTGCCACGACATCTCGAC

Reverse complement sequence

GTCGAGATGTCGTGGCACAGGGCCGGTGTCCTGCTGCTAGGGGCTCAGTCCTGCCTGCCTGTCCCGGGGGTTCCGGCCGTAGGTGGAATTGGGTCGGTAC[T/A]
CTTGTCTATGGCTAGGATAGGTTGGAAACTATGTCACGTCTTCCGTCTGTATACCGTGGTGGTATGTGGCACGTGGTTGCACGTGAGGAAGATGTGTCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.10%	15.20%	5.08%	61.62%	NA
All Indica	2759	1.90%	1.80%	5.80%	90.47%	NA
All Japonica	1512	51.10%	41.00%	2.58%	5.36%	NA
Aus	269	0.00%	2.60%	3.35%	94.05%	NA
Indica I	595	1.30%	2.20%	6.55%	89.92%	NA
Indica II	465	2.20%	2.20%	3.66%	92.04%	NA
Indica III	913	2.00%	0.90%	5.26%	91.89%	NA
Indica Intermediate	786	2.20%	2.40%	7.12%	88.30%	NA
Temperate Japonica	767	32.60%	56.50%	3.65%	7.30%	NA
Tropical Japonica	504	77.60%	17.70%	0.99%	3.77%	NA
Japonica Intermediate	241	54.40%	40.70%	2.49%	2.49%	NA
VI/Aromatic	96	5.20%	19.80%	27.08%	47.92%	NA
Intermediate	90	26.70%	26.70%	6.67%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209042641	A -> DEL	N	N	silent_mutation	Average:17.779; most accessible tissue: Zhenshan97 root, score: 27.411	N	N	N	N
vg1209042641	A -> T	LOC_Os12g15850.1	upstream_gene_variant ; 4272.0bp to feature; MODIFIER	silent_mutation	Average:17.779; most accessible tissue: Zhenshan97 root, score: 27.411	N	N	N	N
vg1209042641	A -> T	LOC_Os12g15870.1	upstream_gene_variant ; 1768.0bp to feature; MODIFIER	silent_mutation	Average:17.779; most accessible tissue: Zhenshan97 root, score: 27.411	N	N	N	N
vg1209042641	A -> T	LOC_Os12g15860.1	downstream_gene_variant ; 477.0bp to feature; MODIFIER	silent_mutation	Average:17.779; most accessible tissue: Zhenshan97 root, score: 27.411	N	N	N	N
vg1209042641	A -> T	LOC_Os12g15860-LOC_Os12g15870	intergenic_region ; MODIFIER	silent_mutation	Average:17.779; most accessible tissue: Zhenshan97 root, score: 27.411	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209042641	2.17E-06	9.97E-14	mr1182	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209042641	NA	2.47E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209042641	NA	3.18E-11	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209042641	NA	2.12E-13	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209042641	NA	8.35E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209042641	NA	9.57E-11	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251