| Variant ID: vg1209001736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 9001736 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATATTGACTCATTGGCTTGTTAATTGATTGCTTCATGTTGACATAACATCTGTCGAATTTTGAGTCTTGTATTTGTGTAGCCCCGACTCTAGAACTGAA[G/A]
CTTCTTGTTGTCGAGTGGTCATTGCTTAATTGAAGATACGTGTTGAAGATGTCTGAGTAGAATTCTTAAAAATTGTAGAAGCACCACTTGTTGTAGTAAA
TTTACTACAACAAGTGGTGCTTCTACAATTTTTAAGAATTCTACTCAGACATCTTCAACACGTATCTTCAATTAAGCAATGACCACTCGACAACAAGAAG[C/T]
TTCAGTTCTAGAGTCGGGGCTACACAAATACAAGACTCAAAATTCGACAGATGTTATGTCAACATGAAGCAATCAATTAACAAGCCAATGAGTCAATATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 1.10% | 2.77% | 20.61% | NA |
| All Indica | 2759 | 64.30% | 0.00% | 2.50% | 33.20% | NA |
| All Japonica | 1512 | 92.20% | 3.20% | 3.57% | 1.06% | NA |
| Aus | 269 | 86.60% | 0.00% | 1.49% | 11.90% | NA |
| Indica I | 595 | 53.90% | 0.00% | 5.88% | 40.17% | NA |
| Indica II | 465 | 64.10% | 0.00% | 1.72% | 34.19% | NA |
| Indica III | 913 | 69.00% | 0.00% | 0.55% | 30.45% | NA |
| Indica Intermediate | 786 | 66.70% | 0.10% | 2.67% | 30.53% | NA |
| Temperate Japonica | 767 | 87.20% | 6.10% | 5.61% | 1.04% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.60% | 0.79% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.40% | 3.32% | 1.66% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 87.80% | 1.10% | 4.44% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1209001736 | G -> DEL | N | N | silent_mutation | Average:27.713; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| vg1209001736 | G -> A | LOC_Os12g15760.1 | upstream_gene_variant ; 3830.0bp to feature; MODIFIER | silent_mutation | Average:27.713; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| vg1209001736 | G -> A | LOC_Os12g15780.1 | upstream_gene_variant ; 3926.0bp to feature; MODIFIER | silent_mutation | Average:27.713; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| vg1209001736 | G -> A | LOC_Os12g15770.1 | downstream_gene_variant ; 2545.0bp to feature; MODIFIER | silent_mutation | Average:27.713; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| vg1209001736 | G -> A | LOC_Os12g15760-LOC_Os12g15770 | intergenic_region ; MODIFIER | silent_mutation | Average:27.713; most accessible tissue: Zhenshan97 young leaf, score: 50.0 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1209001736 | 4.89E-07 | 5.86E-11 | mr1062 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209001736 | NA | 4.38E-07 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1209001736 | NA | 1.37E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |