Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208985713:

Variant ID: vg1208985713 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8985713
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAAGTTGATGGGATGGCACTAGGAGGGTAAGAAAAATGACGGTAAGATTCGACACCCTGCCGATGCTCGACTGTGGAAAAACTTTGAAGCACTACACC[T/C]
GGAATTTGCAAAGGACCCGAGAAATGTAAGGTTTGCATTGAGCACGGACGGAATGAACCCGTTCGGTGACTTAAGCAGCACACACAGCACCTGGCCAGTG

Reverse complement sequence

CACTGGCCAGGTGCTGTGTGTGCTGCTTAAGTCACCGAACGGGTTCATTCCGTCCGTGCTCAATGCAAACCTTACATTTCTCGGGTCCTTTGCAAATTCC[A/G]
GGTGTAGTGCTTCAAAGTTTTTCCACAGTCGAGCATCGGCAGGGTGTCGAATCTTACCGTCATTTTTCTTACCCTCCTAGTGCCATCCCATCAACTTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.60% 37.50% 8.15% 12.78% NA
All Indica  2759 57.00% 9.30% 12.87% 20.80% NA
All Japonica  1512 4.40% 94.50% 0.20% 0.93% NA
Aus  269 82.90% 4.80% 8.92% 3.35% NA
Indica I  595 45.00% 19.80% 16.64% 18.49% NA
Indica II  465 52.70% 10.50% 7.10% 29.68% NA
Indica III  913 65.90% 2.60% 13.03% 18.40% NA
Indica Intermediate  786 58.30% 8.40% 13.23% 20.10% NA
Temperate Japonica  767 5.90% 93.10% 0.13% 0.91% NA
Tropical Japonica  504 3.60% 95.40% 0.20% 0.79% NA
Japonica Intermediate  241 1.20% 97.10% 0.41% 1.24% NA
VI/Aromatic  96 72.90% 24.00% 1.04% 2.08% NA
Intermediate  90 37.80% 54.40% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208985713 T -> C LOC_Os12g15730.1 upstream_gene_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1208985713 T -> C LOC_Os12g15740.1 downstream_gene_variant ; 2605.0bp to feature; MODIFIER silent_mutation Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1208985713 T -> C LOC_Os12g15700-LOC_Os12g15730 intergenic_region ; MODIFIER silent_mutation Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg1208985713 T -> DEL N N silent_mutation Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208985713 NA 1.74E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208985713 4.08E-06 9.07E-06 mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208985713 NA 1.35E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251