Variant ID: vg1208985713 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 8985713 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 68. )
GCCAAGTTGATGGGATGGCACTAGGAGGGTAAGAAAAATGACGGTAAGATTCGACACCCTGCCGATGCTCGACTGTGGAAAAACTTTGAAGCACTACACC[T/C]
GGAATTTGCAAAGGACCCGAGAAATGTAAGGTTTGCATTGAGCACGGACGGAATGAACCCGTTCGGTGACTTAAGCAGCACACACAGCACCTGGCCAGTG
CACTGGCCAGGTGCTGTGTGTGCTGCTTAAGTCACCGAACGGGTTCATTCCGTCCGTGCTCAATGCAAACCTTACATTTCTCGGGTCCTTTGCAAATTCC[A/G]
GGTGTAGTGCTTCAAAGTTTTTCCACAGTCGAGCATCGGCAGGGTGTCGAATCTTACCGTCATTTTTCTTACCCTCCTAGTGCCATCCCATCAACTTGGC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 41.60% | 37.50% | 8.15% | 12.78% | NA |
All Indica | 2759 | 57.00% | 9.30% | 12.87% | 20.80% | NA |
All Japonica | 1512 | 4.40% | 94.50% | 0.20% | 0.93% | NA |
Aus | 269 | 82.90% | 4.80% | 8.92% | 3.35% | NA |
Indica I | 595 | 45.00% | 19.80% | 16.64% | 18.49% | NA |
Indica II | 465 | 52.70% | 10.50% | 7.10% | 29.68% | NA |
Indica III | 913 | 65.90% | 2.60% | 13.03% | 18.40% | NA |
Indica Intermediate | 786 | 58.30% | 8.40% | 13.23% | 20.10% | NA |
Temperate Japonica | 767 | 5.90% | 93.10% | 0.13% | 0.91% | NA |
Tropical Japonica | 504 | 3.60% | 95.40% | 0.20% | 0.79% | NA |
Japonica Intermediate | 241 | 1.20% | 97.10% | 0.41% | 1.24% | NA |
VI/Aromatic | 96 | 72.90% | 24.00% | 1.04% | 2.08% | NA |
Intermediate | 90 | 37.80% | 54.40% | 2.22% | 5.56% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1208985713 | T -> C | LOC_Os12g15730.1 | upstream_gene_variant ; 398.0bp to feature; MODIFIER | silent_mutation | Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
vg1208985713 | T -> C | LOC_Os12g15740.1 | downstream_gene_variant ; 2605.0bp to feature; MODIFIER | silent_mutation | Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
vg1208985713 | T -> C | LOC_Os12g15700-LOC_Os12g15730 | intergenic_region ; MODIFIER | silent_mutation | Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
vg1208985713 | T -> DEL | N | N | silent_mutation | Average:39.711; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1208985713 | NA | 1.74E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208985713 | 4.08E-06 | 9.07E-06 | mr1012 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1208985713 | NA | 1.35E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |