\
| Variant ID: vg1208817900 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8817900 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )
GAGCGACTGCGCCTACCCAATCCCGCCGCCACCTCCCCTTTTCTTGAAGCGACCTCCTCCTTGTAGAAGCCTGAAGCGACCTCCCTCTCGGGCTCTCGGC[G/C,T]
GCCTCCTCCTTGCAGAACGGGAGCAAGTCTGGAGATGGTGGCGGCGCGCGGCGGTGACGGCGAGCGGGTCACGGCGTAGTAGAAGCGACCTCCCTCTCGG
CCGAGAGGGAGGTCGCTTCTACTACGCCGTGACCCGCTCGCCGTCACCGCCGCGCGCCGCCACCATCTCCAGACTTGCTCCCGTTCTGCAAGGAGGAGGC[C/G,A]
GCCGAGAGCCCGAGAGGGAGGTCGCTTCAGGCTTCTACAAGGAGGAGGTCGCTTCAAGAAAAGGGGAGGTGGCGGCGGGATTGGGTAGGCGCAGTCGCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 40.40% | 0.02% | 1.61% | T: 0.36% |
| All Indica | 2759 | 85.00% | 14.30% | 0.00% | 0.25% | T: 0.43% |
| All Japonica | 1512 | 5.20% | 94.30% | 0.00% | 0.53% | NA |
| Aus | 269 | 79.20% | 3.70% | 0.37% | 14.87% | T: 1.86% |
| Indica I | 595 | 79.00% | 20.70% | 0.00% | 0.17% | T: 0.17% |
| Indica II | 465 | 90.30% | 9.50% | 0.00% | 0.22% | NA |
| Indica III | 913 | 86.30% | 13.00% | 0.00% | 0.00% | T: 0.66% |
| Indica Intermediate | 786 | 85.00% | 13.70% | 0.00% | 0.64% | T: 0.64% |
| Temperate Japonica | 767 | 6.80% | 92.20% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 26.00% | 0.00% | 15.62% | NA |
| Intermediate | 90 | 35.60% | 57.80% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208817900 | G -> C | LOC_Os12g15430.1 | upstream_gene_variant ; 3159.0bp to feature; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> C | LOC_Os12g15440.1 | upstream_gene_variant ; 1782.0bp to feature; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> C | LOC_Os12g15450.1 | upstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> C | LOC_Os12g15440-LOC_Os12g15450 | intergenic_region ; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> DEL | N | N | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> T | LOC_Os12g15430.1 | upstream_gene_variant ; 3159.0bp to feature; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> T | LOC_Os12g15440.1 | upstream_gene_variant ; 1782.0bp to feature; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> T | LOC_Os12g15450.1 | upstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| vg1208817900 | G -> T | LOC_Os12g15440-LOC_Os12g15450 | intergenic_region ; MODIFIER | silent_mutation | Average:72.163; most accessible tissue: Callus, score: 81.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208817900 | NA | 4.53E-35 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 3.93E-06 | mr1350 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | 7.46E-06 | 1.59E-28 | mr1350_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 5.04E-06 | mr1350_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 1.93E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 5.08E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 6.38E-06 | mr1509_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 4.64E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 4.51E-12 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 1.63E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 9.06E-18 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 2.07E-08 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 5.25E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208817900 | NA | 3.68E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |