\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208817900:

Variant ID: vg1208817900 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8817900
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCGACTGCGCCTACCCAATCCCGCCGCCACCTCCCCTTTTCTTGAAGCGACCTCCTCCTTGTAGAAGCCTGAAGCGACCTCCCTCTCGGGCTCTCGGC[G/C,T]
GCCTCCTCCTTGCAGAACGGGAGCAAGTCTGGAGATGGTGGCGGCGCGCGGCGGTGACGGCGAGCGGGTCACGGCGTAGTAGAAGCGACCTCCCTCTCGG

Reverse complement sequence

CCGAGAGGGAGGTCGCTTCTACTACGCCGTGACCCGCTCGCCGTCACCGCCGCGCGCCGCCACCATCTCCAGACTTGCTCCCGTTCTGCAAGGAGGAGGC[C/G,A]
GCCGAGAGCCCGAGAGGGAGGTCGCTTCAGGCTTCTACAAGGAGGAGGTCGCTTCAAGAAAAGGGGAGGTGGCGGCGGGATTGGGTAGGCGCAGTCGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 40.40% 0.02% 1.61% T: 0.36%
All Indica  2759 85.00% 14.30% 0.00% 0.25% T: 0.43%
All Japonica  1512 5.20% 94.30% 0.00% 0.53% NA
Aus  269 79.20% 3.70% 0.37% 14.87% T: 1.86%
Indica I  595 79.00% 20.70% 0.00% 0.17% T: 0.17%
Indica II  465 90.30% 9.50% 0.00% 0.22% NA
Indica III  913 86.30% 13.00% 0.00% 0.00% T: 0.66%
Indica Intermediate  786 85.00% 13.70% 0.00% 0.64% T: 0.64%
Temperate Japonica  767 6.80% 92.20% 0.00% 1.04% NA
Tropical Japonica  504 3.80% 96.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.90% 97.10% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 26.00% 0.00% 15.62% NA
Intermediate  90 35.60% 57.80% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208817900 G -> C LOC_Os12g15430.1 upstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> C LOC_Os12g15440.1 upstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> C LOC_Os12g15450.1 upstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> C LOC_Os12g15440-LOC_Os12g15450 intergenic_region ; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> DEL N N silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> T LOC_Os12g15430.1 upstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> T LOC_Os12g15440.1 upstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> T LOC_Os12g15450.1 upstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N
vg1208817900 G -> T LOC_Os12g15440-LOC_Os12g15450 intergenic_region ; MODIFIER silent_mutation Average:72.163; most accessible tissue: Callus, score: 81.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208817900 NA 4.53E-35 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 3.93E-06 mr1350 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 7.46E-06 1.59E-28 mr1350_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 5.04E-06 mr1350_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 1.93E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 5.08E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 6.38E-06 mr1509_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 4.64E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 4.51E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 1.63E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 9.06E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 2.07E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 5.25E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208817900 NA 3.68E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251