\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208814713:

Variant ID: vg1208814713 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8814713
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCGTTTTATCCACTGCAGCAACGGAAACGCGACCTTGCCCATGAGAGCTCCGGAACTCGCACCAGGCGCCGCCGCCATGACGTCGTCGCTGTTCCGG[T/C]
CGACATGGTCCATCTCAAGCCAAGCCATCGCGCCAAAGTCATCGCCTCACCATCATGGCCAAAAGCCCTCAAGAAATTTTAAGAATCGTGCACAGACGAG

Reverse complement sequence

CTCGTCTGTGCACGATTCTTAAAATTTCTTGAGGGCTTTTGGCCATGATGGTGAGGCGATGACTTTGGCGCGATGGCTTGGCTTGAGATGGACCATGTCG[A/G]
CCGGAACAGCGACGACGTCATGGCGGCGGCGCCTGGTGCGAGTTCCGGAGCTCTCATGGGCAAGGTCGCGTTTCCGTTGCTGCAGTGGATAAAACGAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 32.50% 0.74% 1.38% NA
All Indica  2759 97.20% 2.30% 0.29% 0.18% NA
All Japonica  1512 3.50% 92.10% 1.32% 3.11% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 97.60% 2.00% 0.34% 0.00% NA
Indica II  465 96.10% 3.20% 0.22% 0.43% NA
Indica III  913 98.40% 1.40% 0.22% 0.00% NA
Indica Intermediate  786 96.20% 3.10% 0.38% 0.38% NA
Temperate Japonica  767 3.40% 91.80% 0.65% 4.17% NA
Tropical Japonica  504 4.00% 90.70% 2.38% 2.98% NA
Japonica Intermediate  241 2.90% 95.90% 1.24% 0.00% NA
VI/Aromatic  96 55.20% 25.00% 7.29% 12.50% NA
Intermediate  90 45.60% 53.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208814713 T -> C LOC_Os12g15430.1 missense_variant ; p.Asp10Gly; MODERATE nonsynonymous_codon ; D10G Average:43.791; most accessible tissue: Minghui63 panicle, score: 73.225 unknown unknown TOLERATED 1.00
vg1208814713 T -> DEL LOC_Os12g15430.1 N frameshift_variant Average:43.791; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208814713 NA 2.73E-43 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 7.85E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 7.18E-37 mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 3.69E-69 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 4.85E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 2.20E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 2.69E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 2.70E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 1.77E-37 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 2.23E-120 mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 3.81E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 1.19E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 2.93E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 5.19E-06 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 2.75E-07 9.35E-09 mr1750_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 8.86E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 3.10E-32 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 2.75E-66 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 1.91E-67 mr1889_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 1.78E-64 mr1896_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 5.23E-95 mr1907_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 7.16E-84 mr1934_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 3.15E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208814713 NA 1.71E-50 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251