\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208804843:

Variant ID: vg1208804843 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8804843
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGGGTTTGTTAGGATTAGATTAAGGACTCCTCCATCTATATAAGGAGGGATCCTATCCTAGGTCAGTTAGGCATTAGATCAAGATTTATCTTAGTGCC[C/T]
ATCGGCCTGCCTTCTCAGTGCAACAGAGAGCGTCGCGCTGTTTAGGTTCAGGACCGTTCCTTGTTATTTCATCTACTATAATCCAATCTATCCCTATTCA

Reverse complement sequence

TGAATAGGGATAGATTGGATTATAGTAGATGAAATAACAAGGAACGGTCCTGAACCTAAACAGCGCGACGCTCTCTGTTGCACTGAGAAGGCAGGCCGAT[G/A]
GGCACTAAGATAAATCTTGATCTAATGCCTAACTGACCTAGGATAGGATCCCTCCTTATATAGATGGAGGAGTCCTTAATCTAATCCTAACAAACCCTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.90% 0.30% 18.66% 34.19% NA
All Indica  2759 23.60% 0.40% 27.33% 48.60% NA
All Japonica  1512 94.70% 0.00% 0.79% 4.50% NA
Aus  269 14.50% 0.00% 32.71% 52.79% NA
Indica I  595 26.90% 0.20% 18.82% 54.12% NA
Indica II  465 20.00% 1.50% 31.83% 46.67% NA
Indica III  913 22.80% 0.20% 30.56% 46.44% NA
Indica Intermediate  786 24.30% 0.30% 27.35% 48.09% NA
Temperate Japonica  767 93.00% 0.00% 0.91% 6.13% NA
Tropical Japonica  504 96.20% 0.00% 0.60% 3.17% NA
Japonica Intermediate  241 97.10% 0.00% 0.83% 2.07% NA
VI/Aromatic  96 34.40% 0.00% 16.67% 48.96% NA
Intermediate  90 66.70% 0.00% 13.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208804843 C -> DEL N N silent_mutation Average:42.115; most accessible tissue: Minghui63 root, score: 55.188 N N N N
vg1208804843 C -> T LOC_Os12g15420.1 intron_variant ; MODIFIER silent_mutation Average:42.115; most accessible tissue: Minghui63 root, score: 55.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208804843 NA 8.78E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 8.80E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 8.49E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 1.92E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 2.35E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 5.80E-06 1.63E-08 mr1291 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 1.99E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 2.69E-06 mr1335 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 7.32E-06 4.80E-07 mr1471 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 3.64E-07 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 6.31E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 4.34E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 6.02E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 4.74E-07 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 7.32E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 6.09E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 6.00E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 4.96E-08 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 9.11E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 6.94E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 5.21E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 1.26E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208804843 NA 6.08E-08 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251