\
| Variant ID: vg1208774850 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8774850 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 89. )
GCCCCTCATCGGCGAACACAGGAAGGAAATTTTCCTCAAAAACTTTTCGTTAACACGAGAGCAAGTTTTTTACTTTGCAGGAACACAACATAGGTTTCGG[T/C]
AGGAGCATCAGCCGAAAGGGGGCGCCTCGTGGTATACCATACGACTTACACGGTCTCGGCCGAAGCTCCCTACTCACCCTTGCCCGTGAGAGGCTTGTTG
CAACAAGCCTCTCACGGGCAAGGGTGAGTAGGGAGCTTCGGCCGAGACCGTGTAAGTCGTATGGTATACCACGAGGCGCCCCCTTTCGGCTGATGCTCCT[A/G]
CCGAAACCTATGTTGTGTTCCTGCAAAGTAAAAAACTTGCTCTCGTGTTAACGAAAAGTTTTTGAGGAAAATTTCCTTCCTGTGTTCGCCGATGAGGGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.10% | 20.40% | 9.23% | 34.24% | NA |
| All Indica | 2759 | 6.70% | 33.00% | 14.24% | 46.10% | NA |
| All Japonica | 1512 | 94.80% | 0.60% | 0.33% | 4.23% | NA |
| Aus | 269 | 4.10% | 3.30% | 2.97% | 89.59% | NA |
| Indica I | 595 | 4.70% | 23.00% | 5.88% | 66.39% | NA |
| Indica II | 465 | 12.50% | 24.90% | 13.76% | 48.82% | NA |
| Indica III | 913 | 3.40% | 44.70% | 19.50% | 32.42% | NA |
| Indica Intermediate | 786 | 8.50% | 31.70% | 14.76% | 45.04% | NA |
| Temperate Japonica | 767 | 93.50% | 0.80% | 0.39% | 5.35% | NA |
| Tropical Japonica | 504 | 95.80% | 0.60% | 0.40% | 3.17% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 27.10% | 29.20% | 19.79% | 23.96% | NA |
| Intermediate | 90 | 56.70% | 11.10% | 12.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208774850 | T -> C | LOC_Os12g15370.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.943; most accessible tissue: Callus, score: 53.325 | N | N | N | N |
| vg1208774850 | T -> DEL | N | N | silent_mutation | Average:20.943; most accessible tissue: Callus, score: 53.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208774850 | NA | 8.15E-06 | mr1047_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 9.51E-07 | mr1186_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 5.72E-06 | mr1186_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 6.91E-06 | mr1245_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 4.51E-06 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 2.92E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 3.52E-06 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 1.35E-06 | mr1477_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 2.23E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 6.09E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | 7.06E-06 | 7.05E-06 | mr1651_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 5.31E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 9.06E-07 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 2.57E-06 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 9.39E-06 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | 1.78E-06 | 1.79E-06 | mr1697_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | 4.42E-06 | 4.42E-06 | mr1697_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 8.22E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 1.04E-06 | mr1851_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774850 | NA | 8.10E-07 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |