Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208774399:

Variant ID: vg1208774399 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8774399
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GGGACTTGCCAAGGTAGCAAGACCACCCTTCGCCGAGGCTACCGGGGTCTTTGCCGGTTGACCCAGCCTTGGTGGGTTTGCGAGGAGCCATCGAATCCGT[A/G]
GCGAAAAAGGAATCGAAAGGTGAAAAAGAGAACAAGAAAGTCCAAAGGAGCAAGCGCGAGAGCACGGAGGTGGCGAAACGCTAGAGCGCAAGCAAAGGCA

Reverse complement sequence

TGCCTTTGCTTGCGCTCTAGCGTTTCGCCACCTCCGTGCTCTCGCGCTTGCTCCTTTGGACTTTCTTGTTCTCTTTTTCACCTTTCGATTCCTTTTTCGC[T/C]
ACGGATTCGATGGCTCCTCGCAAACCCACCAAGGCTGGGTCAACCGGCAAAGACCCCGGTAGCCTCGGCGAAGGGTGGTCTTGCTACCTTGGCAAGTCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.10%	14.60%	12.76%	37.49%	NA
All Indica	2759	5.00%	22.40%	20.51%	52.16%	NA
All Japonica	1512	94.80%	0.30%	0.53%	4.30%	NA
Aus	269	4.50%	5.20%	5.20%	85.13%	NA
Indica I	595	4.50%	20.50%	7.06%	67.90%	NA
Indica II	465	7.30%	20.90%	16.34%	55.48%	NA
Indica III	913	2.40%	26.10%	30.67%	40.85%	NA
Indica Intermediate	786	6.90%	20.40%	21.37%	51.40%	NA
Temperate Japonica	767	93.50%	0.40%	0.78%	5.35%	NA
Tropical Japonica	504	95.80%	0.40%	0.40%	3.37%	NA
Japonica Intermediate	241	97.10%	0.00%	0.00%	2.90%	NA
VI/Aromatic	96	27.10%	43.80%	7.29%	21.88%	NA
Intermediate	90	57.80%	13.30%	8.89%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208774399	A -> DEL	N	N	silent_mutation	Average:11.93; most accessible tissue: Callus, score: 56.162	N	N	N	N
vg1208774399	A -> G	LOC_Os12g15370.1	intron_variant ; MODIFIER	silent_mutation	Average:11.93; most accessible tissue: Callus, score: 56.162	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208774399	NA	2.42E-06	mr1186_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	8.42E-06	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	8.12E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	2.53E-06	mr1477_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	3.13E-06	3.12E-06	mr1651_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	2.00E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	5.25E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	1.84E-06	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	6.98E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	6.67E-06	6.68E-06	mr1697_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	9.12E-06	9.12E-06	mr1697_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	3.19E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	1.52E-06	mr1851_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208774399	NA	2.99E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251