\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208711764:

Variant ID: vg1208711764 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8711764
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, G: 0.35, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCAAGGGGGGTAATTTGTCTGATACTGAAAGTTCAGGGTGAATGATGACTGGTTTTCGGGTTTAGGGGGGTAATTCGGACAACTGCGATAGTTTGAGG[C/G]
AGTTATTCATACTTTTTCCTTAGTATTACATGAAATAAATTCAAAATATGAATATAGTGATGTAGCATGTATAATACTTAGAATAGATATAGTTTGTATG

Reverse complement sequence

CATACAAACTATATCTATTCTAAGTATTATACATGCTACATCACTATATTCATATTTTGAATTTATTTCATGTAATACTAAGGAAAAAGTATGAATAACT[G/C]
CCTCAAACTATCGCAGTTGTCCGAATTACCCCCCTAAACCCGAAAACCAGTCATCATTCACCCTGAACTTTCAGTATCAGACAAATTACCCCCCTTGACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.90% 21.70% 0.42% 55.95% NA
All Indica  2759 11.40% 7.00% 0.58% 81.01% NA
All Japonica  1512 45.10% 50.30% 0.20% 4.37% NA
Aus  269 1.10% 8.20% 0.37% 90.33% NA
Indica I  595 18.70% 7.70% 0.84% 72.77% NA
Indica II  465 6.50% 9.90% 0.22% 83.44% NA
Indica III  913 9.30% 3.70% 0.33% 86.64% NA
Indica Intermediate  786 11.20% 8.70% 0.89% 79.26% NA
Temperate Japonica  767 18.60% 75.50% 0.39% 5.48% NA
Tropical Japonica  504 77.20% 19.20% 0.00% 3.57% NA
Japonica Intermediate  241 62.20% 35.30% 0.00% 2.49% NA
VI/Aromatic  96 8.30% 20.80% 0.00% 70.83% NA
Intermediate  90 31.10% 33.30% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208711764 C -> DEL N N silent_mutation Average:11.957; most accessible tissue: Callus, score: 60.728 N N N N
vg1208711764 C -> G LOC_Os12g15270.1 upstream_gene_variant ; 314.0bp to feature; MODIFIER silent_mutation Average:11.957; most accessible tissue: Callus, score: 60.728 N N N N
vg1208711764 C -> G LOC_Os12g15280.1 upstream_gene_variant ; 3382.0bp to feature; MODIFIER silent_mutation Average:11.957; most accessible tissue: Callus, score: 60.728 N N N N
vg1208711764 C -> G LOC_Os12g15270-LOC_Os12g15280 intergenic_region ; MODIFIER silent_mutation Average:11.957; most accessible tissue: Callus, score: 60.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208711764 NA 6.31E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208711764 3.82E-06 4.34E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 1.26E-10 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.01E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.76E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.10E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 4.07E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 1.91E-06 mr1578 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 4.49E-07 2.54E-14 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.24E-15 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 4.15E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 8.79E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 4.53E-10 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 5.85E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 3.66E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 5.88E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 4.36E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 7.78E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 3.88E-10 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 7.36E-11 mr1453_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.74E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 1.38E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.76E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 8.26E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 6.03E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.36E-06 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 6.40E-07 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.96E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 1.68E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 9.23E-07 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 9.40E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 4.05E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 3.72E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 1.94E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 7.35E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 8.08E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 2.80E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208711764 NA 4.42E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251