\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208708611:

Variant ID: vg1208708611 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8708611
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCAGGACGCAGGGCATCAGGATTCAGGGCTGGCCGCCGCTACATCGCCGGGAAAGCAGGGATCCTTGCCATCGACAGCTAGTTATCCAGTGCTGGCAG[A/C]
CCTTTCCTCTTGCTCAGAACGTGTTTCTTGTTTGCTCTCTTCATTTTTTTTATTCATACAGCGGCTAATACGATGTAACGATGTAACTATATGTATGGTA

Reverse complement sequence

TACCATACATATAGTTACATCGTTACATCGTATTAGCCGCTGTATGAATAAAAAAAATGAAGAGAGCAAACAAGAAACACGTTCTGAGCAAGAGGAAAGG[T/G]
CTGCCAGCACTGGATAACTAGCTGTCGATGGCAAGGATCCCTGCTTTCCCGGCGATGTAGCGGCGGCCAGCCCTGAATCCTGATGCCCTGCGTCCTGGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.20% 5.40% 5.29% 56.05% NA
All Indica  2759 13.50% 1.00% 4.24% 81.26% NA
All Japonica  1512 74.50% 14.40% 6.81% 4.30% NA
Aus  269 4.10% 0.00% 5.95% 89.96% NA
Indica I  595 20.50% 0.80% 6.22% 72.44% NA
Indica II  465 8.60% 2.40% 5.16% 83.87% NA
Indica III  913 11.70% 0.20% 0.99% 87.08% NA
Indica Intermediate  786 13.20% 1.10% 5.98% 79.64% NA
Temperate Japonica  767 54.50% 27.20% 12.91% 5.35% NA
Tropical Japonica  504 96.40% 0.00% 0.00% 3.57% NA
Japonica Intermediate  241 92.50% 3.30% 1.66% 2.49% NA
VI/Aromatic  96 27.10% 0.00% 2.08% 70.83% NA
Intermediate  90 36.70% 14.40% 13.33% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208708611 A -> C LOC_Os12g15270.1 downstream_gene_variant ; 2180.0bp to feature; MODIFIER silent_mutation Average:10.079; most accessible tissue: Callus, score: 54.609 N N N N
vg1208708611 A -> C LOC_Os12g15250-LOC_Os12g15270 intergenic_region ; MODIFIER silent_mutation Average:10.079; most accessible tissue: Callus, score: 54.609 N N N N
vg1208708611 A -> DEL N N silent_mutation Average:10.079; most accessible tissue: Callus, score: 54.609 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208708611 NA 2.02E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 6.29E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 2.86E-07 NA mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 3.44E-11 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 4.49E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 4.26E-06 8.87E-14 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 8.50E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 7.09E-06 2.25E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 3.70E-12 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 1.23E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 1.12E-09 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 1.92E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 3.09E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611 NA 4.60E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251