Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208708611:

Variant ID: vg1208708611 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8708611
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCAGGACGCAGGGCATCAGGATTCAGGGCTGGCCGCCGCTACATCGCCGGGAAAGCAGGGATCCTTGCCATCGACAGCTAGTTATCCAGTGCTGGCAG[A/C]
CCTTTCCTCTTGCTCAGAACGTGTTTCTTGTTTGCTCTCTTCATTTTTTTTATTCATACAGCGGCTAATACGATGTAACGATGTAACTATATGTATGGTA

Reverse complement sequence

TACCATACATATAGTTACATCGTTACATCGTATTAGCCGCTGTATGAATAAAAAAAATGAAGAGAGCAAACAAGAAACACGTTCTGAGCAAGAGGAAAGG[T/G]
CTGCCAGCACTGGATAACTAGCTGTCGATGGCAAGGATCCCTGCTTTCCCGGCGATGTAGCGGCGGCCAGCCCTGAATCCTGATGCCCTGCGTCCTGGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.20%	5.40%	5.29%	56.05%	NA
All Indica	2759	13.50%	1.00%	4.24%	81.26%	NA
All Japonica	1512	74.50%	14.40%	6.81%	4.30%	NA
Aus	269	4.10%	0.00%	5.95%	89.96%	NA
Indica I	595	20.50%	0.80%	6.22%	72.44%	NA
Indica II	465	8.60%	2.40%	5.16%	83.87%	NA
Indica III	913	11.70%	0.20%	0.99%	87.08%	NA
Indica Intermediate	786	13.20%	1.10%	5.98%	79.64%	NA
Temperate Japonica	767	54.50%	27.20%	12.91%	5.35%	NA
Tropical Japonica	504	96.40%	0.00%	0.00%	3.57%	NA
Japonica Intermediate	241	92.50%	3.30%	1.66%	2.49%	NA
VI/Aromatic	96	27.10%	0.00%	2.08%	70.83%	NA
Intermediate	90	36.70%	14.40%	13.33%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208708611	A -> C	LOC_Os12g15270.1	downstream_gene_variant ; 2180.0bp to feature; MODIFIER	silent_mutation	Average:10.079; most accessible tissue: Callus, score: 54.609	N	N	N	N
vg1208708611	A -> C	LOC_Os12g15250-LOC_Os12g15270	intergenic_region ; MODIFIER	silent_mutation	Average:10.079; most accessible tissue: Callus, score: 54.609	N	N	N	N
vg1208708611	A -> DEL	N	N	silent_mutation	Average:10.079; most accessible tissue: Callus, score: 54.609	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208708611	NA	2.02E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	6.29E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	2.86E-07	NA	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	3.44E-11	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	4.49E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	4.26E-06	8.87E-14	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	8.50E-10	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	7.09E-06	2.25E-21	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	3.70E-12	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	1.23E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	1.12E-09	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	1.92E-12	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	3.09E-07	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208708611	NA	4.60E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251