\
| Variant ID: vg1208693304 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8693304 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )
AGCTAGGACTTGTCCTTCTTCTCAGATTTCGTTTATCTCTGTTGCCCAGAAGTTCCTGGCTCAAGAACTCCGGAAGTTCCGGGCTACTCATCAATGCCCG[G/A]
AAGTTCTAGTGTTCATCACCAGGAGGTTCCGAGCCCTGTCAATTTAACCGCTGCGATTGTTGAGAAAATTTCAGGATAGCCTATTCACCCTCCTATAGGC
GCCTATAGGAGGGTGAATAGGCTATCCTGAAATTTTCTCAACAATCGCAGCGGTTAAATTGACAGGGCTCGGAACCTCCTGGTGATGAACACTAGAACTT[C/T]
CGGGCATTGATGAGTAGCCCGGAACTTCCGGAGTTCTTGAGCCAGGAACTTCTGGGCAACAGAGATAAACGAAATCTGAGAAGAAGGACAAGTCCTAGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.20% | 6.40% | 0.57% | 55.82% | NA |
| All Indica | 2759 | 7.40% | 10.70% | 0.69% | 81.19% | NA |
| All Japonica | 1512 | 95.70% | 0.00% | 0.00% | 4.30% | NA |
| Aus | 269 | 9.70% | 1.10% | 2.97% | 86.25% | NA |
| Indica I | 595 | 7.10% | 18.50% | 0.84% | 73.61% | NA |
| Indica II | 465 | 10.50% | 5.80% | 1.29% | 82.37% | NA |
| Indica III | 913 | 4.60% | 8.70% | 0.44% | 86.31% | NA |
| Indica Intermediate | 786 | 9.00% | 10.20% | 0.51% | 80.28% | NA |
| Temperate Japonica | 767 | 94.70% | 0.00% | 0.00% | 5.35% | NA |
| Tropical Japonica | 504 | 96.40% | 0.00% | 0.00% | 3.57% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 29.20% | 1.00% | 0.00% | 69.79% | NA |
| Intermediate | 90 | 57.80% | 4.40% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208693304 | G -> DEL | N | N | silent_mutation | Average:26.257; most accessible tissue: Callus, score: 56.096 | N | N | N | N |
| vg1208693304 | G -> A | LOC_Os12g15240.1 | upstream_gene_variant ; 4347.0bp to feature; MODIFIER | silent_mutation | Average:26.257; most accessible tissue: Callus, score: 56.096 | N | N | N | N |
| vg1208693304 | G -> A | LOC_Os12g15250.1 | upstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:26.257; most accessible tissue: Callus, score: 56.096 | N | N | N | N |
| vg1208693304 | G -> A | LOC_Os12g15250-LOC_Os12g15270 | intergenic_region ; MODIFIER | silent_mutation | Average:26.257; most accessible tissue: Callus, score: 56.096 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208693304 | 6.11E-06 | NA | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | 2.62E-06 | NA | mr1140 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | 3.41E-07 | 3.84E-06 | mr1203 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | 1.54E-07 | NA | mr1395 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | NA | 1.16E-19 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | 1.46E-06 | 9.35E-06 | mr1618 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | NA | 9.23E-06 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | NA | 5.10E-15 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | NA | 4.97E-25 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208693304 | NA | 5.03E-06 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |