\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208693304:

Variant ID: vg1208693304 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8693304
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTAGGACTTGTCCTTCTTCTCAGATTTCGTTTATCTCTGTTGCCCAGAAGTTCCTGGCTCAAGAACTCCGGAAGTTCCGGGCTACTCATCAATGCCCG[G/A]
AAGTTCTAGTGTTCATCACCAGGAGGTTCCGAGCCCTGTCAATTTAACCGCTGCGATTGTTGAGAAAATTTCAGGATAGCCTATTCACCCTCCTATAGGC

Reverse complement sequence

GCCTATAGGAGGGTGAATAGGCTATCCTGAAATTTTCTCAACAATCGCAGCGGTTAAATTGACAGGGCTCGGAACCTCCTGGTGATGAACACTAGAACTT[C/T]
CGGGCATTGATGAGTAGCCCGGAACTTCCGGAGTTCTTGAGCCAGGAACTTCTGGGCAACAGAGATAAACGAAATCTGAGAAGAAGGACAAGTCCTAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 6.40% 0.57% 55.82% NA
All Indica  2759 7.40% 10.70% 0.69% 81.19% NA
All Japonica  1512 95.70% 0.00% 0.00% 4.30% NA
Aus  269 9.70% 1.10% 2.97% 86.25% NA
Indica I  595 7.10% 18.50% 0.84% 73.61% NA
Indica II  465 10.50% 5.80% 1.29% 82.37% NA
Indica III  913 4.60% 8.70% 0.44% 86.31% NA
Indica Intermediate  786 9.00% 10.20% 0.51% 80.28% NA
Temperate Japonica  767 94.70% 0.00% 0.00% 5.35% NA
Tropical Japonica  504 96.40% 0.00% 0.00% 3.57% NA
Japonica Intermediate  241 97.50% 0.00% 0.00% 2.49% NA
VI/Aromatic  96 29.20% 1.00% 0.00% 69.79% NA
Intermediate  90 57.80% 4.40% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208693304 G -> DEL N N silent_mutation Average:26.257; most accessible tissue: Callus, score: 56.096 N N N N
vg1208693304 G -> A LOC_Os12g15240.1 upstream_gene_variant ; 4347.0bp to feature; MODIFIER silent_mutation Average:26.257; most accessible tissue: Callus, score: 56.096 N N N N
vg1208693304 G -> A LOC_Os12g15250.1 upstream_gene_variant ; 2495.0bp to feature; MODIFIER silent_mutation Average:26.257; most accessible tissue: Callus, score: 56.096 N N N N
vg1208693304 G -> A LOC_Os12g15250-LOC_Os12g15270 intergenic_region ; MODIFIER silent_mutation Average:26.257; most accessible tissue: Callus, score: 56.096 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208693304 6.11E-06 NA mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 2.62E-06 NA mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 3.41E-07 3.84E-06 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 1.54E-07 NA mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 NA 1.16E-19 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 1.46E-06 9.35E-06 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 NA 9.23E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 NA 5.10E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 NA 4.97E-25 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304 NA 5.03E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251