Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208693304:

Variant ID: vg1208693304 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8693304
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTAGGACTTGTCCTTCTTCTCAGATTTCGTTTATCTCTGTTGCCCAGAAGTTCCTGGCTCAAGAACTCCGGAAGTTCCGGGCTACTCATCAATGCCCG[G/A]
AAGTTCTAGTGTTCATCACCAGGAGGTTCCGAGCCCTGTCAATTTAACCGCTGCGATTGTTGAGAAAATTTCAGGATAGCCTATTCACCCTCCTATAGGC

Reverse complement sequence

GCCTATAGGAGGGTGAATAGGCTATCCTGAAATTTTCTCAACAATCGCAGCGGTTAAATTGACAGGGCTCGGAACCTCCTGGTGATGAACACTAGAACTT[C/T]
CGGGCATTGATGAGTAGCCCGGAACTTCCGGAGTTCTTGAGCCAGGAACTTCTGGGCAACAGAGATAAACGAAATCTGAGAAGAAGGACAAGTCCTAGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.20%	6.40%	0.57%	55.82%	NA
All Indica	2759	7.40%	10.70%	0.69%	81.19%	NA
All Japonica	1512	95.70%	0.00%	0.00%	4.30%	NA
Aus	269	9.70%	1.10%	2.97%	86.25%	NA
Indica I	595	7.10%	18.50%	0.84%	73.61%	NA
Indica II	465	10.50%	5.80%	1.29%	82.37%	NA
Indica III	913	4.60%	8.70%	0.44%	86.31%	NA
Indica Intermediate	786	9.00%	10.20%	0.51%	80.28%	NA
Temperate Japonica	767	94.70%	0.00%	0.00%	5.35%	NA
Tropical Japonica	504	96.40%	0.00%	0.00%	3.57%	NA
Japonica Intermediate	241	97.50%	0.00%	0.00%	2.49%	NA
VI/Aromatic	96	29.20%	1.00%	0.00%	69.79%	NA
Intermediate	90	57.80%	4.40%	0.00%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208693304	G -> DEL	N	N	silent_mutation	Average:26.257; most accessible tissue: Callus, score: 56.096	N	N	N	N
vg1208693304	G -> A	LOC_Os12g15240.1	upstream_gene_variant ; 4347.0bp to feature; MODIFIER	silent_mutation	Average:26.257; most accessible tissue: Callus, score: 56.096	N	N	N	N
vg1208693304	G -> A	LOC_Os12g15250.1	upstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:26.257; most accessible tissue: Callus, score: 56.096	N	N	N	N
vg1208693304	G -> A	LOC_Os12g15250-LOC_Os12g15270	intergenic_region ; MODIFIER	silent_mutation	Average:26.257; most accessible tissue: Callus, score: 56.096	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208693304	6.11E-06	NA	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	2.62E-06	NA	mr1140	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	3.41E-07	3.84E-06	mr1203	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	1.54E-07	NA	mr1395	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	NA	1.16E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	1.46E-06	9.35E-06	mr1618	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	NA	9.23E-06	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	NA	5.10E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	NA	4.97E-25	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208693304	NA	5.03E-06	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251