Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1208680127:

Variant ID: vg1208680127 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8680127
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGTTTCACTATGTACGGATCAAATGTTGCAGTGGATTTTGATATTATGGAACGCGCCGTTACAACAAAAAAACCCACGTATTTTGGAAACCCCCTATT[A/C]
ACGGAATTCGTTTTATTTTTTGTTCCACCAAAAATGTTTCACCTAGTGTACTCACACTGCTTCACTATTTATAGATCTAATGTTGCAGTGATTTGAGATA

Reverse complement sequence

TATCTCAAATCACTGCAACATTAGATCTATAAATAGTGAAGCAGTGTGAGTACACTAGGTGAAACATTTTTGGTGGAACAAAAAATAAAACGAATTCCGT[T/G]
AATAGGGGGTTTCCAAAATACGTGGGTTTTTTTGTTGTAACGGCGCGTTCCATAATATCAAAATCCACTGCAACATTTGATCCGTACATAGTGAAACATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.20%	2.70%	4.19%	37.94%	NA
All Indica	2759	35.40%	3.90%	4.49%	56.18%	NA
All Japonica	1512	96.80%	0.10%	1.32%	1.72%	NA
Aus	269	17.50%	4.10%	8.18%	70.26%	NA
Indica I	595	38.80%	0.50%	2.35%	58.32%	NA
Indica II	465	37.60%	0.20%	5.59%	56.56%	NA
Indica III	913	32.50%	6.90%	4.49%	56.08%	NA
Indica Intermediate	786	34.90%	5.20%	5.47%	54.45%	NA
Temperate Japonica	767	96.10%	0.10%	1.04%	2.74%	NA
Tropical Japonica	504	97.40%	0.20%	1.98%	0.40%	NA
Japonica Intermediate	241	97.90%	0.00%	0.83%	1.24%	NA
VI/Aromatic	96	57.30%	0.00%	26.04%	16.67%	NA
Intermediate	90	73.30%	5.60%	7.78%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208680127	A -> C	LOC_Os12g15222.1	upstream_gene_variant ; 644.0bp to feature; MODIFIER	silent_mutation	Average:11.948; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1208680127	A -> C	LOC_Os12g15222.3	upstream_gene_variant ; 656.0bp to feature; MODIFIER	silent_mutation	Average:11.948; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1208680127	A -> C	LOC_Os12g15222.2	upstream_gene_variant ; 656.0bp to feature; MODIFIER	silent_mutation	Average:11.948; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1208680127	A -> C	LOC_Os12g15222-LOC_Os12g15240	intergenic_region ; MODIFIER	silent_mutation	Average:11.948; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1208680127	A -> DEL	N	N	silent_mutation	Average:11.948; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208680127	2.17E-09	2.17E-09	mr1191_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251