Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208648368:

Variant ID: vg1208648368 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8648368
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAGCTGAGCAAATCCGCAACATTACCAATATAGCGGACTTGGGGGGCATGTGTTAACGACCAAATTTGGTAAGCCATGAACCAGGTTCAACATTGGAAT[C/T]
GAAGTGGATTCTGCGGGGAATCGTCTTCCGGAGACAGAGTGCGCATCGGCTGTGAAGGCATCGGCTGAAGACTGCATCGGCTGAGATGGATCGGATGGAA

Reverse complement sequence

TTCCATCCGATCCATCTCAGCCGATGCAGTCTTCAGCCGATGCCTTCACAGCCGATGCGCACTCTGTCTCCGGAAGACGATTCCCCGCAGAATCCACTTC[G/A]
ATTCCAATGTTGAACCTGGTTCATGGCTTACCAAATTTGGTCGTTAACACATGCCCCCCAAGTCCGCTATATTGGTAATGTTGCGGATTTGCTCAGCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	0.70%	3.34%	45.90%	NA
All Indica	2759	39.40%	1.20%	3.12%	56.36%	NA
All Japonica	1512	69.30%	0.00%	1.06%	29.63%	NA
Aus	269	31.60%	0.40%	18.22%	49.81%	NA
Indica I	595	68.90%	0.50%	2.02%	28.57%	NA
Indica II	465	32.00%	1.70%	2.80%	63.44%	NA
Indica III	913	19.10%	1.40%	3.94%	75.58%	NA
Indica Intermediate	786	44.90%	1.00%	3.18%	50.89%	NA
Temperate Japonica	767	85.00%	0.00%	0.00%	14.99%	NA
Tropical Japonica	504	44.20%	0.00%	2.98%	52.78%	NA
Japonica Intermediate	241	71.80%	0.00%	0.41%	27.80%	NA
VI/Aromatic	96	88.50%	0.00%	1.04%	10.42%	NA
Intermediate	90	68.90%	0.00%	6.67%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208648368	C -> DEL	N	N	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 26.319	N	N	N	N
vg1208648368	C -> T	LOC_Os12g15160.1	upstream_gene_variant ; 1240.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 26.319	N	N	N	N
vg1208648368	C -> T	LOC_Os12g15180.1	upstream_gene_variant ; 3582.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 26.319	N	N	N	N
vg1208648368	C -> T	LOC_Os12g15150.1	downstream_gene_variant ; 4286.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 26.319	N	N	N	N
vg1208648368	C -> T	LOC_Os12g15170.1	downstream_gene_variant ; 1321.0bp to feature; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 26.319	N	N	N	N
vg1208648368	C -> T	LOC_Os12g15160-LOC_Os12g15170	intergenic_region ; MODIFIER	silent_mutation	Average:7.576; most accessible tissue: Callus, score: 26.319	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208648368	NA	4.24E-07	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	2.28E-06	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	1.38E-07	8.55E-14	mr1109	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	2.06E-09	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.48E-06	mr1235	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	5.54E-06	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.56E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	9.26E-08	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	2.38E-07	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	3.11E-07	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.31E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	6.35E-06	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.08E-06	mr1599	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	6.19E-06	mr1692	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	4.95E-06	8.21E-12	mr1109_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.77E-10	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	2.94E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	2.04E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	8.33E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.60E-07	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.63E-10	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	8.77E-07	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	6.71E-06	mr1863_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368	NA	1.89E-06	mr1880_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251