\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208648368:

Variant ID: vg1208648368 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8648368
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGCTGAGCAAATCCGCAACATTACCAATATAGCGGACTTGGGGGGCATGTGTTAACGACCAAATTTGGTAAGCCATGAACCAGGTTCAACATTGGAAT[C/T]
GAAGTGGATTCTGCGGGGAATCGTCTTCCGGAGACAGAGTGCGCATCGGCTGTGAAGGCATCGGCTGAAGACTGCATCGGCTGAGATGGATCGGATGGAA

Reverse complement sequence

TTCCATCCGATCCATCTCAGCCGATGCAGTCTTCAGCCGATGCCTTCACAGCCGATGCGCACTCTGTCTCCGGAAGACGATTCCCCGCAGAATCCACTTC[G/A]
ATTCCAATGTTGAACCTGGTTCATGGCTTACCAAATTTGGTCGTTAACACATGCCCCCCAAGTCCGCTATATTGGTAATGTTGCGGATTTGCTCAGCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 0.70% 3.34% 45.90% NA
All Indica  2759 39.40% 1.20% 3.12% 56.36% NA
All Japonica  1512 69.30% 0.00% 1.06% 29.63% NA
Aus  269 31.60% 0.40% 18.22% 49.81% NA
Indica I  595 68.90% 0.50% 2.02% 28.57% NA
Indica II  465 32.00% 1.70% 2.80% 63.44% NA
Indica III  913 19.10% 1.40% 3.94% 75.58% NA
Indica Intermediate  786 44.90% 1.00% 3.18% 50.89% NA
Temperate Japonica  767 85.00% 0.00% 0.00% 14.99% NA
Tropical Japonica  504 44.20% 0.00% 2.98% 52.78% NA
Japonica Intermediate  241 71.80% 0.00% 0.41% 27.80% NA
VI/Aromatic  96 88.50% 0.00% 1.04% 10.42% NA
Intermediate  90 68.90% 0.00% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208648368 C -> DEL N N silent_mutation Average:7.576; most accessible tissue: Callus, score: 26.319 N N N N
vg1208648368 C -> T LOC_Os12g15160.1 upstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 26.319 N N N N
vg1208648368 C -> T LOC_Os12g15180.1 upstream_gene_variant ; 3582.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 26.319 N N N N
vg1208648368 C -> T LOC_Os12g15150.1 downstream_gene_variant ; 4286.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 26.319 N N N N
vg1208648368 C -> T LOC_Os12g15170.1 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 26.319 N N N N
vg1208648368 C -> T LOC_Os12g15160-LOC_Os12g15170 intergenic_region ; MODIFIER silent_mutation Average:7.576; most accessible tissue: Callus, score: 26.319 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208648368 NA 4.24E-07 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 2.28E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 1.38E-07 8.55E-14 mr1109 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 2.06E-09 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.48E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 5.54E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.56E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 9.26E-08 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 2.38E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 3.11E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.31E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 6.35E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.08E-06 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 6.19E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 4.95E-06 8.21E-12 mr1109_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.77E-10 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 2.94E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 2.04E-08 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 8.33E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.60E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.63E-10 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 8.77E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 6.71E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208648368 NA 1.89E-06 mr1880_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251