\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208638766:

Variant ID: vg1208638766 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8638766
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCCAAAGTCAAAGTAGACATGTTAACAGACTCCTGAATAGATGTAACTTTCATCACCCAAATAGACATGTCAAGACCATTCAAAAAGTGACGAGAAA[T/C]
CTCAGATTGTGGATAATTAGCATCATGAGAAGAATCAACAGATCTAAGATCACTCAAAATTTTATTAAACCTAGAAAGATAGTCATCCAAAGCTTCTCTA

Reverse complement sequence

TAGAGAAGCTTTGGATGACTATCTTTCTAGGTTTAATAAAATTTTGAGTGATCTTAGATCTGTTGATTCTTCTCATGATGCTAATTATCCACAATCTGAG[A/G]
TTTCTCGTCACTTTTTGAATGGTCTTGACATGTCTATTTGGGTGATGAAAGTTACATCTATTCAGGAGTCTGTTAACATGTCTACTTTGACTTTGGATTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.50% 3.40% 8.89% 45.15% NA
All Indica  2759 36.80% 4.00% 9.13% 50.09% NA
All Japonica  1512 55.90% 2.80% 6.28% 35.05% NA
Aus  269 24.50% 1.50% 17.84% 56.13% NA
Indica I  595 63.70% 7.40% 6.05% 22.86% NA
Indica II  465 34.80% 5.40% 10.11% 49.68% NA
Indica III  913 15.10% 2.00% 10.51% 72.40% NA
Indica Intermediate  786 42.60% 3.10% 9.29% 45.04% NA
Temperate Japonica  767 81.10% 3.10% 2.09% 13.69% NA
Tropical Japonica  504 23.00% 2.20% 7.14% 67.66% NA
Japonica Intermediate  241 44.40% 2.90% 17.84% 34.85% NA
VI/Aromatic  96 37.50% 1.00% 22.92% 38.54% NA
Intermediate  90 53.30% 5.60% 3.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208638766 T -> C LOC_Os12g15140.1 missense_variant ; p.Ile259Val; MODERATE nonsynonymous_codon ; I259V Average:9.033; most accessible tissue: Callus, score: 26.423 unknown unknown TOLERATED 0.11
vg1208638766 T -> DEL LOC_Os12g15140.1 N frameshift_variant Average:9.033; most accessible tissue: Callus, score: 26.423 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208638766 NA 9.02E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 4.02E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 2.20E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 1.08E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 5.23E-07 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 2.11E-09 mr1124_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 3.69E-07 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 1.31E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 6.21E-06 mr1763_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 2.04E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208638766 NA 4.27E-06 mr1957_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251