Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208635661:

Variant ID: vg1208635661 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8635661
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACTTTTGACAATGATTTCATCAAGCATAGGAATTATATTCATTAATGTATAAGAGCTTAACATACATATAGCATATCATGTCATGTGTTGCAATAAAAA[C/G]
AAGATGAATCCATCTATAATATAACAAGCATGCATTAAAGTATAACCATGAACCAAAGATTTTACAATTAAGCTTGAATCAACAATCAAAATTCATGATT

Reverse complement sequence

AATCATGAATTTTGATTGTTGATTCAAGCTTAATTGTAAAATCTTTGGTTCATGGTTATACTTTAATGCATGCTTGTTATATTATAGATGGATTCATCTT[G/C]
TTTTTATTGCAACACATGACATGATATGCTATATGTATGTTAAGCTCTTATACATTAATGAATATAATTCCTATGCTTGATGAAATCATTGTCAAAAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 2.80% 34.74% 19.83% NA
All Indica  2759 37.00% 4.80% 55.78% 2.36% NA
All Japonica  1512 55.70% 0.00% 1.52% 42.79% NA
Aus  269 24.90% 0.40% 17.84% 56.88% NA
Indica I  595 65.20% 4.50% 28.40% 1.85% NA
Indica II  465 35.50% 5.40% 56.77% 2.37% NA
Indica III  913 14.20% 4.50% 79.19% 2.08% NA
Indica Intermediate  786 43.10% 5.10% 48.73% 3.05% NA
Temperate Japonica  767 81.50% 0.00% 1.17% 17.34% NA
Tropical Japonica  504 23.00% 0.00% 2.38% 74.60% NA
Japonica Intermediate  241 41.90% 0.00% 0.83% 57.26% NA
VI/Aromatic  96 33.30% 0.00% 12.50% 54.17% NA
Intermediate  90 55.60% 0.00% 22.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208635661 C -> DEL N N silent_mutation Average:7.63; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1208635661 C -> G LOC_Os12g15130.1 upstream_gene_variant ; 3449.0bp to feature; MODIFIER silent_mutation Average:7.63; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N
vg1208635661 C -> G LOC_Os12g15140.1 intron_variant ; MODIFIER silent_mutation Average:7.63; most accessible tissue: Zhenshan97 root, score: 12.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208635661 NA 1.12E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.24E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 3.41E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.24E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.77E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.31E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.94E-16 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 3.89E-09 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 3.10E-08 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 3.05E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 8.34E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.49E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.01E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 3.77E-06 NA mr1162_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 7.97E-10 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 7.45E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 3.38E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.76E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.47E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.27E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 3.64E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.86E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 5.45E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 8.01E-13 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.36E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 3.49E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 6.14E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.32E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.23E-07 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.50E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 1.07E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 9.96E-07 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208635661 NA 2.75E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251