Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1208634025:

Variant ID: vg1208634025 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8634025
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCTTGATAATATGGGCGTGGTTGGTTCCACCCCTGACCTCCTTGTGGACAATACCCGTTGTTGTTGTTGCCCATGTACATCGCCTCCTTACGGGTTTC[C/T]
GGGCAGTCATTCCCAGAATGACCCGTGTTGCCGCATGTAGGATTGAATCACAAGAACTAAGCCAACCAGAGGGGGGGTGAATGGTTGATATACCCAAAAA

Reverse complement sequence

TTTTTGGGTATATCAACCATTCACCCCCCCTCTGGTTGGCTTAGTTCTTGTGATTCAATCCTACATGCGGCAACACGGGTCATTCTGGGAATGACTGCCC[G/A]
GAAACCCGTAAGGAGGCGATGTACATGGGCAACAACAACAACGGGTATTGTCCACAAGGAGGTCAGGGGTGGAACCAACCACGCCCATATTATCAAGGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.30%	0.40%	7.58%	32.78%	NA
All Indica	2759	57.00%	0.50%	8.63%	33.93%	NA
All Japonica	1512	65.30%	0.20%	4.23%	30.22%	NA
Aus	269	47.20%	0.40%	15.99%	36.43%	NA
Indica I	595	78.00%	0.20%	5.71%	16.13%	NA
Indica II	465	48.40%	0.40%	9.89%	41.29%	NA
Indica III	913	45.60%	0.90%	10.19%	43.37%	NA
Indica Intermediate	786	59.40%	0.30%	8.27%	32.06%	NA
Temperate Japonica	767	82.40%	0.00%	0.78%	16.82%	NA
Tropical Japonica	504	47.60%	0.60%	9.52%	42.26%	NA
Japonica Intermediate	241	48.10%	0.00%	4.15%	47.72%	NA
VI/Aromatic	96	54.20%	0.00%	7.29%	38.54%	NA
Intermediate	90	70.00%	0.00%	6.67%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208634025	C -> DEL	N	N	silent_mutation	Average:16.747; most accessible tissue: Callus, score: 33.564	N	N	N	N
vg1208634025	C -> T	LOC_Os12g15120.1	upstream_gene_variant ; 4203.0bp to feature; MODIFIER	silent_mutation	Average:16.747; most accessible tissue: Callus, score: 33.564	N	N	N	N
vg1208634025	C -> T	LOC_Os12g15130.1	upstream_gene_variant ; 1813.0bp to feature; MODIFIER	silent_mutation	Average:16.747; most accessible tissue: Callus, score: 33.564	N	N	N	N
vg1208634025	C -> T	LOC_Os12g15140.1	intron_variant ; MODIFIER	silent_mutation	Average:16.747; most accessible tissue: Callus, score: 33.564	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208634025	NA	1.82E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	3.76E-06	NA	mr1040_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	NA	4.03E-06	mr1217_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	1.42E-06	NA	mr1308_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	2.37E-06	3.59E-07	mr1345_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	5.04E-06	NA	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	3.86E-06	1.56E-06	mr1415_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	1.89E-06	NA	mr1422_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	5.15E-06	5.16E-06	mr1424_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	NA	8.84E-09	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	3.72E-06	1.07E-07	mr1562_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	NA	2.73E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	1.48E-06	4.60E-08	mr1735_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	6.57E-07	NA	mr1830_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	4.06E-06	5.29E-06	mr1849_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	5.88E-06	NA	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	7.88E-06	2.80E-06	mr1854_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	NA	1.06E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	7.45E-06	NA	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025	4.09E-06	NA	mr1943_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251