\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208634025:

Variant ID: vg1208634025 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8634025
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCTTGATAATATGGGCGTGGTTGGTTCCACCCCTGACCTCCTTGTGGACAATACCCGTTGTTGTTGTTGCCCATGTACATCGCCTCCTTACGGGTTTC[C/T]
GGGCAGTCATTCCCAGAATGACCCGTGTTGCCGCATGTAGGATTGAATCACAAGAACTAAGCCAACCAGAGGGGGGGTGAATGGTTGATATACCCAAAAA

Reverse complement sequence

TTTTTGGGTATATCAACCATTCACCCCCCCTCTGGTTGGCTTAGTTCTTGTGATTCAATCCTACATGCGGCAACACGGGTCATTCTGGGAATGACTGCCC[G/A]
GAAACCCGTAAGGAGGCGATGTACATGGGCAACAACAACAACGGGTATTGTCCACAAGGAGGTCAGGGGTGGAACCAACCACGCCCATATTATCAAGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 0.40% 7.58% 32.78% NA
All Indica  2759 57.00% 0.50% 8.63% 33.93% NA
All Japonica  1512 65.30% 0.20% 4.23% 30.22% NA
Aus  269 47.20% 0.40% 15.99% 36.43% NA
Indica I  595 78.00% 0.20% 5.71% 16.13% NA
Indica II  465 48.40% 0.40% 9.89% 41.29% NA
Indica III  913 45.60% 0.90% 10.19% 43.37% NA
Indica Intermediate  786 59.40% 0.30% 8.27% 32.06% NA
Temperate Japonica  767 82.40% 0.00% 0.78% 16.82% NA
Tropical Japonica  504 47.60% 0.60% 9.52% 42.26% NA
Japonica Intermediate  241 48.10% 0.00% 4.15% 47.72% NA
VI/Aromatic  96 54.20% 0.00% 7.29% 38.54% NA
Intermediate  90 70.00% 0.00% 6.67% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208634025 C -> DEL N N silent_mutation Average:16.747; most accessible tissue: Callus, score: 33.564 N N N N
vg1208634025 C -> T LOC_Os12g15120.1 upstream_gene_variant ; 4203.0bp to feature; MODIFIER silent_mutation Average:16.747; most accessible tissue: Callus, score: 33.564 N N N N
vg1208634025 C -> T LOC_Os12g15130.1 upstream_gene_variant ; 1813.0bp to feature; MODIFIER silent_mutation Average:16.747; most accessible tissue: Callus, score: 33.564 N N N N
vg1208634025 C -> T LOC_Os12g15140.1 intron_variant ; MODIFIER silent_mutation Average:16.747; most accessible tissue: Callus, score: 33.564 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208634025 NA 1.82E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 3.76E-06 NA mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 NA 4.03E-06 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 1.42E-06 NA mr1308_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 2.37E-06 3.59E-07 mr1345_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 5.04E-06 NA mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 3.86E-06 1.56E-06 mr1415_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 1.89E-06 NA mr1422_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 5.15E-06 5.16E-06 mr1424_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 NA 8.84E-09 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 3.72E-06 1.07E-07 mr1562_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 NA 2.73E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 1.48E-06 4.60E-08 mr1735_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 6.57E-07 NA mr1830_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 4.06E-06 5.29E-06 mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 5.88E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 7.88E-06 2.80E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 NA 1.06E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 7.45E-06 NA mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208634025 4.09E-06 NA mr1943_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251