\
| Variant ID: vg1208631130 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8631130 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACGAGAGGAACTTGAGCGCCATTCACTTGGAGATGGAGGCACATCACTTGATCTGGAAGGATGGTTGTCCCCCCATTGGATGTCATGAGGCGCACGCCA[C/T]
CGGTCCTCACTGGTACTTGCCCAGGTTGAGACTCCGATGCTGTGACGTGGAGCTTGGGTCCATCCAGGTGCATCCCAGTTGGCTCCCAACCTGCCTCATA
TATGAGGCAGGTTGGGAGCCAACTGGGATGCACCTGGATGGACCCAAGCTCCACGTCACAGCATCGGAGTCTCAACCTGGGCAAGTACCAGTGAGGACCG[G/A]
TGGCGTGCGCCTCATGACATCCAATGGGGGGACAACCATCCTTCCAGATCAAGTGATGTGCCTCCATCTCCAAGTGAATGGCGCTCAAGTTCCTCTCGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.20% | 0.10% | 3.45% | 13.20% | NA |
| All Indica | 2759 | 86.50% | 0.20% | 2.61% | 10.69% | NA |
| All Japonica | 1512 | 75.20% | 0.10% | 4.56% | 20.11% | NA |
| Aus | 269 | 89.60% | 0.00% | 4.83% | 5.58% | NA |
| Indica I | 595 | 92.60% | 0.50% | 3.19% | 3.70% | NA |
| Indica II | 465 | 85.60% | 0.00% | 4.73% | 9.68% | NA |
| Indica III | 913 | 80.00% | 0.00% | 0.88% | 19.17% | NA |
| Indica Intermediate | 786 | 90.10% | 0.30% | 2.93% | 6.74% | NA |
| Temperate Japonica | 767 | 86.30% | 0.00% | 4.82% | 8.87% | NA |
| Tropical Japonica | 504 | 68.10% | 0.40% | 4.56% | 26.98% | NA |
| Japonica Intermediate | 241 | 54.80% | 0.00% | 3.73% | 41.49% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 5.21% | 8.33% | NA |
| Intermediate | 90 | 93.30% | 0.00% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208631130 | C -> DEL | N | N | silent_mutation | Average:10.553; most accessible tissue: Callus, score: 25.256 | N | N | N | N |
| vg1208631130 | C -> T | LOC_Os12g15120.1 | upstream_gene_variant ; 1308.0bp to feature; MODIFIER | silent_mutation | Average:10.553; most accessible tissue: Callus, score: 25.256 | N | N | N | N |
| vg1208631130 | C -> T | LOC_Os12g15140.1 | downstream_gene_variant ; 1801.0bp to feature; MODIFIER | silent_mutation | Average:10.553; most accessible tissue: Callus, score: 25.256 | N | N | N | N |
| vg1208631130 | C -> T | LOC_Os12g15130.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.553; most accessible tissue: Callus, score: 25.256 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208631130 | NA | 3.25E-07 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208631130 | 6.88E-06 | NA | mr1156_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208631130 | NA | 1.43E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208631130 | NA | 6.04E-06 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208631130 | NA | 1.30E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208631130 | NA | 2.42E-08 | mr1952_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208631130 | NA | 1.21E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |