| Variant ID: vg1208630420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8630420 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATGTATATGGTTTAATGATGATAGCACATTTTTGGCACTGGTAGGAATTTATATCATTTTGAAAAACAAAACATCCAAAATTCAAGTCAAACTAGTATC[A/G]
GGATCATAGCAACTCATATTTACTATCTCATATCTCACAACAACTTAGACTTAGATCAGCAAGTGCAGCGCATTACCTTAGGTTCCCGGATAATTGTTGG
CCAACAATTATCCGGGAACCTAAGGTAATGCGCTGCACTTGCTGATCTAAGTCTAAGTTGTTGTGAGATATGAGATAGTAAATATGAGTTGCTATGATCC[T/C]
GATACTAGTTTGACTTGAATTTTGGATGTTTTGTTTTTCAAAATGATATAAATTCCTACCAGTGCCAAAAATGTGCTATCATCATTAAACCATATACATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 0.10% | 1.86% | 44.05% | NA |
| All Indica | 2759 | 52.20% | 0.10% | 1.59% | 46.10% | NA |
| All Japonica | 1512 | 59.80% | 0.00% | 1.46% | 38.76% | NA |
| Aus | 269 | 34.60% | 0.00% | 7.43% | 57.99% | NA |
| Indica I | 595 | 73.90% | 0.20% | 0.67% | 25.21% | NA |
| Indica II | 465 | 54.40% | 0.60% | 1.72% | 43.23% | NA |
| Indica III | 913 | 32.20% | 0.00% | 1.31% | 66.48% | NA |
| Indica Intermediate | 786 | 57.50% | 0.00% | 2.54% | 39.95% | NA |
| Temperate Japonica | 767 | 83.70% | 0.00% | 0.52% | 15.78% | NA |
| Tropical Japonica | 504 | 30.00% | 0.00% | 2.58% | 67.46% | NA |
| Japonica Intermediate | 241 | 46.10% | 0.00% | 2.07% | 51.87% | NA |
| VI/Aromatic | 96 | 60.40% | 0.00% | 1.04% | 38.54% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 1.11% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208630420 | A -> DEL | N | N | silent_mutation | Average:7.83; most accessible tissue: Callus, score: 25.57 | N | N | N | N |
| vg1208630420 | A -> G | LOC_Os12g15120.1 | upstream_gene_variant ; 598.0bp to feature; MODIFIER | silent_mutation | Average:7.83; most accessible tissue: Callus, score: 25.57 | N | N | N | N |
| vg1208630420 | A -> G | LOC_Os12g15130.1 | downstream_gene_variant ; 395.0bp to feature; MODIFIER | silent_mutation | Average:7.83; most accessible tissue: Callus, score: 25.57 | N | N | N | N |
| vg1208630420 | A -> G | LOC_Os12g15140.1 | downstream_gene_variant ; 2511.0bp to feature; MODIFIER | silent_mutation | Average:7.83; most accessible tissue: Callus, score: 25.57 | N | N | N | N |
| vg1208630420 | A -> G | LOC_Os12g15120-LOC_Os12g15130 | intergenic_region ; MODIFIER | silent_mutation | Average:7.83; most accessible tissue: Callus, score: 25.57 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208630420 | 1.18E-06 | 3.39E-06 | mr1363 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208630420 | NA | 2.54E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208630420 | NA | 2.23E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |