\
| Variant ID: vg1208604811 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8604811 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 82. )
CTCTGCTCGTGCAAAGTCACCTTCTGTGCGAGATTTGACAAACTCTCCAAATCTTGAGCCGAAAACTTCCCCTTGATTGGTGCTATCAACCCTTGAAAAG[T/C]
CAGATCGGCTAGCTGAGAATCTGTCAAGGACAAGCTGTAACACTTATTCCTCATCTCCCTGAATATTTCAATGTAATCTTGTACAGACTCATCATGCCTT
AAGGCATGATGAGTCTGTACAAGATTACATTGAAATATTCAGGGAGATGAGGAATAAGTGTTACAGCTTGTCCTTGACAGATTCTCAGCTAGCCGATCTG[A/G]
CTTTTCAAGGGTTGATAGCACCAATCAAGGGGAAGTTTTCGGCTCAAGATTTGGAGAGTTTGTCAAATCTCGCACAGAAGGTGACTTTGCACGAGCAGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 10.70% | 1.86% | 57.41% | NA |
| All Indica | 2759 | 23.60% | 13.70% | 2.36% | 60.31% | NA |
| All Japonica | 1512 | 42.40% | 7.30% | 1.06% | 49.27% | NA |
| Aus | 269 | 22.30% | 1.90% | 1.12% | 74.72% | NA |
| Indica I | 595 | 44.50% | 19.80% | 0.84% | 34.79% | NA |
| Indica II | 465 | 28.40% | 6.20% | 2.37% | 63.01% | NA |
| Indica III | 913 | 3.40% | 14.50% | 2.74% | 79.41% | NA |
| Indica Intermediate | 786 | 28.40% | 12.70% | 3.05% | 55.85% | NA |
| Temperate Japonica | 767 | 65.60% | 2.10% | 0.00% | 32.33% | NA |
| Tropical Japonica | 504 | 12.70% | 17.70% | 2.38% | 67.26% | NA |
| Japonica Intermediate | 241 | 30.70% | 2.10% | 1.66% | 65.56% | NA |
| VI/Aromatic | 96 | 31.20% | 4.20% | 2.08% | 62.50% | NA |
| Intermediate | 90 | 41.10% | 8.90% | 2.22% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208604811 | T -> C | LOC_Os12g15070.1 | missense_variant ; p.Thr19Ala; MODERATE | nonsynonymous_codon ; T19V | Average:9.72; most accessible tissue: Callus, score: 47.001 | benign |
1.253 |
DELETERIOUS | 0.02 |
| vg1208604811 | T -> C | LOC_Os12g15070.1 | missense_variant ; p.Thr19Ala; MODERATE | nonsynonymous_codon ; T19A | Average:9.72; most accessible tissue: Callus, score: 47.001 | benign |
-0.097 |
TOLERATED | 1.00 |
| vg1208604811 | T -> DEL | LOC_Os12g15070.1 | N | frameshift_variant | Average:9.72; most accessible tissue: Callus, score: 47.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208604811 | NA | 9.28E-07 | mr1047_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 1.19E-06 | mr1160_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 7.76E-07 | mr1160_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 4.39E-07 | mr1186_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 3.76E-06 | mr1616_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 8.44E-08 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 6.42E-07 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | 4.79E-06 | 2.55E-08 | mr1655_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 1.55E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 9.16E-06 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 2.52E-07 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208604811 | NA | 3.15E-07 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |