| Variant ID: vg1208558919 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8558919 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATTTGATGGTCGGCGTGGCAATAGGCTTCGCTTCGTAGACTAGTTTCCCAGCCGTTGCAAAGACTTCGTGAGAACGGTCAGGGGCACGAATTCGCCAAG[C/T]
TAGGGCAAACAAAGCCGTCCGGCCCTACCAGATTAAGAATGCGAAGGCCTTTCCTTCGAAAGGAGAAAAAAAATAGCTATGCTATTGACCGACCCTTTCG
CGAAAGGGTCGGTCAATAGCATAGCTATTTTTTTTCTCCTTTCGAAGGAAAGGCCTTCGCATTCTTAATCTGGTAGGGCCGGACGGCTTTGTTTGCCCTA[G/A]
CTTGGCGAATTCGTGCCCCTGACCGTTCTCACGAAGTCTTTGCAACGGCTGGGAAACTAGTCTACGAAGCGAAGCCTATTGCCACGCCGACCATCAAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.80% | 1.10% | 1.06% | 52.03% | NA |
| All Indica | 2759 | 23.20% | 0.10% | 1.38% | 75.35% | NA |
| All Japonica | 1512 | 92.40% | 3.40% | 0.20% | 4.03% | NA |
| Aus | 269 | 12.60% | 0.00% | 1.49% | 85.87% | NA |
| Indica I | 595 | 36.30% | 0.30% | 1.85% | 61.51% | NA |
| Indica II | 465 | 23.00% | 0.00% | 1.29% | 75.70% | NA |
| Indica III | 913 | 13.90% | 0.00% | 1.31% | 84.78% | NA |
| Indica Intermediate | 786 | 24.00% | 0.10% | 1.15% | 74.68% | NA |
| Temperate Japonica | 767 | 87.90% | 6.60% | 0.26% | 5.22% | NA |
| Tropical Japonica | 504 | 96.60% | 0.00% | 0.20% | 3.17% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 32.30% | 0.00% | 4.17% | 63.54% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 1.11% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208558919 | C -> DEL | N | N | silent_mutation | Average:6.679; most accessible tissue: Callus, score: 23.011 | N | N | N | N |
| vg1208558919 | C -> T | LOC_Os12g14960.1 | downstream_gene_variant ; 3186.0bp to feature; MODIFIER | silent_mutation | Average:6.679; most accessible tissue: Callus, score: 23.011 | N | N | N | N |
| vg1208558919 | C -> T | LOC_Os12g14939-LOC_Os12g14960 | intergenic_region ; MODIFIER | silent_mutation | Average:6.679; most accessible tissue: Callus, score: 23.011 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208558919 | NA | 3.37E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208558919 | NA | 3.79E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208558919 | 2.87E-06 | 2.87E-06 | mr1525 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208558919 | NA | 1.78E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |