\
| Variant ID: vg1208553492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8553492 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 81. )
GCGGCATAATAGGCCAGCCGTGTAGGCGGAGACACCAGTCGGCGGCGGCGAAGGCAAGCCGGTCGGTGAAGATGTGGTCGCCCATGAATGGTGGTGTGAC[T/C]
AACCAACCTTATAGGCGAGGACATCAGTCGGCAACAGCAGTGCTGTGGTCATTACATATAAACAACAAAAAATACCAAGAGATTAATCAGATTTACAGAG
CTCTGTAAATCTGATTAATCTCTTGGTATTTTTTGTTGTTTATATGTAATGACCACAGCACTGCTGTTGCCGACTGATGTCCTCGCCTATAAGGTTGGTT[A/G]
GTCACACCACCATTCATGGGCGACCACATCTTCACCGACCGGCTTGCCTTCGCCGCCGCCGACTGGTGTCTCCGCCTACACGGCTGGCCTATTATGCCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.60% | 20.30% | 19.74% | 14.37% | NA |
| All Indica | 2759 | 44.90% | 9.90% | 30.05% | 15.22% | NA |
| All Japonica | 1512 | 55.80% | 40.30% | 0.93% | 2.98% | NA |
| Aus | 269 | 7.40% | 8.90% | 26.39% | 57.25% | NA |
| Indica I | 595 | 51.40% | 15.80% | 28.07% | 4.71% | NA |
| Indica II | 465 | 28.60% | 14.80% | 35.05% | 21.51% | NA |
| Indica III | 913 | 51.40% | 1.80% | 26.73% | 20.15% | NA |
| Indica Intermediate | 786 | 42.00% | 11.80% | 32.44% | 13.74% | NA |
| Temperate Japonica | 767 | 30.80% | 63.90% | 1.04% | 4.30% | NA |
| Tropical Japonica | 504 | 86.30% | 10.90% | 0.79% | 1.98% | NA |
| Japonica Intermediate | 241 | 71.40% | 27.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 17.70% | 25.00% | 8.33% | 48.96% | NA |
| Intermediate | 90 | 40.00% | 33.30% | 12.22% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208553492 | T -> C | LOC_Os12g14939-LOC_Os12g14960 | intergenic_region ; MODIFIER | silent_mutation | Average:26.944; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg1208553492 | T -> DEL | N | N | silent_mutation | Average:26.944; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208553492 | NA | 4.47E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1208553492 | NA | 7.37E-13 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 5.24E-13 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 7.19E-08 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 1.25E-09 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 2.25E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 2.26E-08 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 4.20E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | 5.51E-09 | 2.02E-18 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | 3.22E-10 | 6.97E-21 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 2.36E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 5.71E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 3.10E-09 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 1.33E-15 | mr1013_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 3.93E-10 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | 2.80E-06 | 8.82E-16 | mr1031_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 1.74E-12 | mr1031_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 7.70E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 5.67E-08 | mr1563_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 5.71E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 4.01E-06 | mr1870_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 1.76E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208553492 | NA | 7.88E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |